Incidental Mutation 'R6954:Hsf2'
ID541376
Institutional Source Beutler Lab
Gene Symbol Hsf2
Ensembl Gene ENSMUSG00000019878
Gene Nameheat shock factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location57486385-57513135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57504643 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 191 (I191N)
Ref Sequence ENSEMBL: ENSMUSP00000152013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079833] [ENSMUST00000220042] [ENSMUST00000220353]
Predicted Effect probably damaging
Transcript: ENSMUST00000079833
AA Change: I248N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078761
Gene: ENSMUSG00000019878
AA Change: I248N

DomainStartEndE-ValueType
HSF 6 110 1.99e-62 SMART
coiled coil region 133 176 N/A INTRINSIC
Pfam:Vert_HS_TF 230 392 1.5e-39 PFAM
Pfam:Vert_HS_TF 391 494 2.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000220042
AA Change: I191N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220353
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased late-gestational lethality associated with collapsed lateral ventricles and ventricular bleeding. Survivors may show ventricular dilation, sterility in females, and reduced sperm counts in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Hsf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Hsf2 APN 10 57512028 missense probably benign 0.00
IGL00965:Hsf2 APN 10 57512100 missense probably damaging 1.00
IGL01338:Hsf2 APN 10 57501379 missense probably damaging 1.00
IGL01518:Hsf2 APN 10 57512134 missense probably damaging 1.00
IGL01721:Hsf2 APN 10 57496181 missense probably benign 0.13
IGL02219:Hsf2 APN 10 57496274 missense probably damaging 1.00
IGL03493:Hsf2 APN 10 57505366 missense probably damaging 1.00
R0270:Hsf2 UTSW 10 57502639 missense probably benign 0.28
R1774:Hsf2 UTSW 10 57512146 missense probably damaging 1.00
R2406:Hsf2 UTSW 10 57497546 missense probably damaging 0.96
R3410:Hsf2 UTSW 10 57505282 missense probably damaging 1.00
R4829:Hsf2 UTSW 10 57496170 missense probably damaging 0.96
R4958:Hsf2 UTSW 10 57501371 missense probably damaging 0.99
R5154:Hsf2 UTSW 10 57504712 missense probably benign
R5237:Hsf2 UTSW 10 57506221 missense probably benign 0.16
R5903:Hsf2 UTSW 10 57504723 missense probably benign
R6125:Hsf2 UTSW 10 57512005 missense probably benign
R6126:Hsf2 UTSW 10 57495917 missense probably damaging 1.00
R6280:Hsf2 UTSW 10 57511495 missense probably benign 0.03
R6309:Hsf2 UTSW 10 57486580 start gained probably benign
R6966:Hsf2 UTSW 10 57495984 missense probably damaging 1.00
R7088:Hsf2 UTSW 10 57512092 missense probably damaging 1.00
R7182:Hsf2 UTSW 10 57505176 missense possibly damaging 0.87
R7511:Hsf2 UTSW 10 57504557 missense probably benign 0.00
Z1088:Hsf2 UTSW 10 57496168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACACTTTGGGTATGTCATTCATC -3'
(R):5'- GGTAGTTATCTGGGTCAATAATTCC -3'

Sequencing Primer
(F):5'- GACTGAGGACAAGCAGTTTTGTTTAC -3'
(R):5'- TGTGAAAAAGATTAGTACTCCAAACC -3'
Posted On2018-11-28