Incidental Mutation 'R6954:Pcdh15'
ID541377
Institutional Source Beutler Lab
Gene Symbol Pcdh15
Ensembl Gene ENSMUSG00000052613
Gene Nameprotocadherin 15
SynonymsGm9815, nmf19, Ush1f
MMRRC Submission
Accession Numbers

Genbank: NM_023115; Ensembl: ENSMUST00000105425

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location73099342-74649737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74645989 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1651 (H1651Y)
Ref Sequence ENSEMBL: ENSMUSP00000141973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124046] [ENSMUST00000125517] [ENSMUST00000131724] [ENSMUST00000144302] [ENSMUST00000146682] [ENSMUST00000149977] [ENSMUST00000151116] [ENSMUST00000152655] [ENSMUST00000152819] [ENSMUST00000155701] [ENSMUST00000177107] [ENSMUST00000191709] [ENSMUST00000191854] [ENSMUST00000193174] [ENSMUST00000193739] [ENSMUST00000195531]
Predicted Effect probably benign
Transcript: ENSMUST00000124046
SMART Domains Protein: ENSMUSP00000121130
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
CA 30 118 7.87e-9 SMART
CA 142 224 4.88e-14 SMART
CA 249 326 4.65e-20 SMART
CA 350 428 1.93e-26 SMART
CA 452 535 5.69e-15 SMART
CA 559 645 6.85e-9 SMART
CA 666 753 3.09e-16 SMART
CA 777 861 4.49e-4 SMART
transmembrane domain 986 1008 N/A INTRINSIC
low complexity region 1029 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125517
SMART Domains Protein: ENSMUSP00000115399
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
low complexity region 430 468 N/A INTRINSIC
low complexity region 521 584 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131724
SMART Domains Protein: ENSMUSP00000122466
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144302
SMART Domains Protein: ENSMUSP00000122606
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
low complexity region 313 326 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146682
AA Change: H389Y

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134863
Gene: ENSMUSG00000052613
AA Change: H389Y

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000149977
AA Change: H1649Y

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118833
Gene: ENSMUSG00000052613
AA Change: H1649Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151116
SMART Domains Protein: ENSMUSP00000119662
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 519 7.87e-9 SMART
CA 543 625 4.88e-14 SMART
CA 650 727 4.65e-20 SMART
CA 751 829 1.93e-26 SMART
CA 853 936 5.69e-15 SMART
CA 960 1046 6.85e-9 SMART
CA 1067 1154 3.09e-16 SMART
CA 1178 1262 4.49e-4 SMART
transmembrane domain 1387 1409 N/A INTRINSIC
low complexity region 1430 1457 N/A INTRINSIC
low complexity region 1489 1519 N/A INTRINSIC
low complexity region 1521 1539 N/A INTRINSIC
low complexity region 1592 1655 N/A INTRINSIC
low complexity region 1681 1712 N/A INTRINSIC
low complexity region 1728 1756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152655
SMART Domains Protein: ENSMUSP00000118201
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 726 3.4e-6 SMART
low complexity region 783 846 N/A INTRINSIC
low complexity region 872 903 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152819
SMART Domains Protein: ENSMUSP00000123647
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 363 1e-33 BLAST
low complexity region 364 399 N/A INTRINSIC
low complexity region 452 515 N/A INTRINSIC
low complexity region 541 572 N/A INTRINSIC
low complexity region 588 616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155701
SMART Domains Protein: ENSMUSP00000135495
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 330 2e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000177107
AA Change: H1656Y

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135501
Gene: ENSMUSG00000052613
AA Change: H1656Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1482 1499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191709
SMART Domains Protein: ENSMUSP00000142313
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1480 1510 N/A INTRINSIC
low complexity region 1512 1530 N/A INTRINSIC
low complexity region 1583 1646 N/A INTRINSIC
low complexity region 1672 1703 N/A INTRINSIC
low complexity region 1719 1747 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191854
AA Change: H1651Y

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141973
Gene: ENSMUSG00000052613
AA Change: H1651Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193174
SMART Domains Protein: ENSMUSP00000142238
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 514 3.8e-11 SMART
CA 538 620 2.3e-16 SMART
CA 645 722 2.3e-22 SMART
CA 746 824 9.3e-29 SMART
CA 848 931 2.8e-17 SMART
CA 955 1041 3.3e-11 SMART
CA 1062 1149 1.5e-18 SMART
CA 1173 1257 2.3e-6 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1425 1452 N/A INTRINSIC
low complexity region 1482 1512 N/A INTRINSIC
low complexity region 1514 1532 N/A INTRINSIC
low complexity region 1585 1648 N/A INTRINSIC
low complexity region 1674 1705 N/A INTRINSIC
low complexity region 1721 1749 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193739
AA Change: H1651Y

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142173
Gene: ENSMUSG00000052613
AA Change: H1651Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1420 1447 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195531
AA Change: H1688Y

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141920
Gene: ENSMUSG00000052613
AA Change: H1688Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 715 2.3e-22 SMART
CA 739 817 9.3e-29 SMART
CA 841 924 2.8e-17 SMART
CA 948 1034 3.3e-11 SMART
CA 1055 1142 1.5e-18 SMART
CA 1166 1250 2.3e-6 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1514 1531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygotes for severe mutations exhibit circling, head-tossing, hyperactivity, impaired swimming and profound deafness. Mice have defects in cochlea and degeneration of hair cells, spiral ganglion cells and saccular macula. Females are poor mothers. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Transgenic(1) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Pcdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pcdh15 APN 10 74185345 nonsense probably null
IGL00432:Pcdh15 APN 10 74291082 splice site probably benign
IGL00533:Pcdh15 APN 10 74502720 missense probably damaging 1.00
IGL00596:Pcdh15 APN 10 74630744 missense probably benign 0.00
IGL00930:Pcdh15 APN 10 74630698 missense probably benign 0.08
IGL00970:Pcdh15 APN 10 74379340 missense probably damaging 1.00
IGL01087:Pcdh15 APN 10 74342632 missense possibly damaging 0.90
IGL01763:Pcdh15 APN 10 74210461 missense probably benign 0.09
IGL01787:Pcdh15 APN 10 74450283 missense probably benign 0.25
IGL02070:Pcdh15 APN 10 74630868 missense probably benign 0.00
IGL02234:Pcdh15 APN 10 74631862 missense probably benign 0.02
IGL02268:Pcdh15 APN 10 74342672 missense probably damaging 1.00
IGL02280:Pcdh15 APN 10 74222463 missense probably damaging 1.00
IGL02363:Pcdh15 APN 10 74317086 missense probably damaging 0.98
IGL02420:Pcdh15 APN 10 74303106 missense probably damaging 0.98
IGL02749:Pcdh15 APN 10 74631068 missense probably benign 0.00
IGL02939:Pcdh15 APN 10 74504816 splice site probably benign
IGL02970:Pcdh15 APN 10 74290962 splice site probably benign
IGL03010:Pcdh15 APN 10 74385945 missense probably damaging 1.00
IGL03061:Pcdh15 APN 10 74317011 missense probably damaging 0.97
IGL03095:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03149:Pcdh15 APN 10 74630695 missense probably damaging 1.00
IGL03187:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03279:Pcdh15 APN 10 74317072 missense probably damaging 1.00
IGL03392:Pcdh15 APN 10 74624272 missense probably damaging 1.00
loop UTSW 10 74185378 missense probably damaging 1.00
mcduck UTSW 10 74626844 critical splice donor site probably null
spaz UTSW 10 74210425 missense probably damaging 1.00
sphere UTSW 10 74624284 missense probably damaging 1.00
squirm UTSW 10 large deletion
Tortilla UTSW 10 74379417 splice site probably null
1mM(1):Pcdh15 UTSW 10 74626137 intron probably benign
R0038:Pcdh15 UTSW 10 74643440 missense possibly damaging 0.95
R0103:Pcdh15 UTSW 10 74210425 missense probably damaging 1.00
R0110:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0111:Pcdh15 UTSW 10 74626819 nonsense probably null
R0119:Pcdh15 UTSW 10 74170575 missense probably damaging 1.00
R0131:Pcdh15 UTSW 10 74170608 missense probably null 1.00
R0445:Pcdh15 UTSW 10 74342549 missense probably damaging 1.00
R0464:Pcdh15 UTSW 10 74626844 critical splice donor site probably null
R0503:Pcdh15 UTSW 10 74210385 missense probably damaging 1.00
R0507:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0510:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0742:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0790:Pcdh15 UTSW 10 74631053 missense probably benign 0.01
R0829:Pcdh15 UTSW 10 74502766 missense probably damaging 1.00
R0839:Pcdh15 UTSW 10 74626782 missense probably null 1.00
R0882:Pcdh15 UTSW 10 74342656 missense probably damaging 1.00
R0894:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R0944:Pcdh15 UTSW 10 74210470 missense probably damaging 0.99
R1081:Pcdh15 UTSW 10 74450313 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1484:Pcdh15 UTSW 10 74291001 missense probably damaging 1.00
R1521:Pcdh15 UTSW 10 74594191 missense probably damaging 1.00
R1694:Pcdh15 UTSW 10 74594163 missense probably damaging 1.00
R1795:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R2021:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2022:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2023:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2076:Pcdh15 UTSW 10 74342647 missense probably damaging 1.00
R2199:Pcdh15 UTSW 10 74170509 missense probably damaging 1.00
R2510:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R2511:Pcdh15 UTSW 10 74645996 missense possibly damaging 0.94
R3418:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3419:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3433:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R3619:Pcdh15 UTSW 10 74643395 missense probably damaging 0.99
R3723:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3724:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3778:Pcdh15 UTSW 10 73947151 splice site probably null
R3851:Pcdh15 UTSW 10 74631686 missense probably damaging 0.97
R4175:Pcdh15 UTSW 10 74631997 intron probably benign
R4261:Pcdh15 UTSW 10 74645680 missense probably damaging 1.00
R4385:Pcdh15 UTSW 10 74550490 missense probably damaging 1.00
R4585:Pcdh15 UTSW 10 74624284 missense probably damaging 1.00
R4602:Pcdh15 UTSW 10 74594214 missense probably damaging 1.00
R4639:Pcdh15 UTSW 10 74643607 missense probably benign 0.00
R4703:Pcdh15 UTSW 10 74450163 missense probably damaging 1.00
R4819:Pcdh15 UTSW 10 74324389 missense probably damaging 1.00
R4906:Pcdh15 UTSW 10 74504793 nonsense probably null
R4961:Pcdh15 UTSW 10 74379417 splice site probably null
R5018:Pcdh15 UTSW 10 74643775 missense possibly damaging 0.68
R5125:Pcdh15 UTSW 10 74584080 missense probably damaging 0.98
R5225:Pcdh15 UTSW 10 74303154 missense probably damaging 1.00
R5259:Pcdh15 UTSW 10 74396372 missense possibly damaging 0.67
R5279:Pcdh15 UTSW 10 74594183 missense probably damaging 1.00
R5395:Pcdh15 UTSW 10 74185287 missense probably damaging 1.00
R5458:Pcdh15 UTSW 10 74504779 missense probably damaging 1.00
R5617:Pcdh15 UTSW 10 74635672 intron probably benign
R5665:Pcdh15 UTSW 10 74626788 missense probably damaging 1.00
R5770:Pcdh15 UTSW 10 74185345 nonsense probably null
R5805:Pcdh15 UTSW 10 74230259 missense probably damaging 1.00
R5914:Pcdh15 UTSW 10 74630936 missense probably benign 0.42
R5988:Pcdh15 UTSW 10 74379357 missense probably benign 0.05
R6133:Pcdh15 UTSW 10 74645973 unclassified probably null
R6189:Pcdh15 UTSW 10 74342651 missense probably null 1.00
R6414:Pcdh15 UTSW 10 74185426 missense probably damaging 1.00
R6536:Pcdh15 UTSW 10 74631389 missense probably damaging 1.00
R6612:Pcdh15 UTSW 10 74185378 missense probably damaging 1.00
R6711:Pcdh15 UTSW 10 74642387 missense possibly damaging 0.83
R6793:Pcdh15 UTSW 10 74631139 missense probably damaging 1.00
R6841:Pcdh15 UTSW 10 74450220 missense probably damaging 1.00
R6845:Pcdh15 UTSW 10 74630633 missense probably benign
R6915:Pcdh15 UTSW 10 74643809 missense probably benign 0.16
R6970:Pcdh15 UTSW 10 74502687 missense probably damaging 0.98
R7018:Pcdh15 UTSW 10 74466354 missense probably damaging 1.00
R7064:Pcdh15 UTSW 10 74630614 missense possibly damaging 0.67
R7079:Pcdh15 UTSW 10 74317125 missense probably benign 0.21
R7172:Pcdh15 UTSW 10 74502765 missense probably damaging 1.00
R7220:Pcdh15 UTSW 10 74342609 missense possibly damaging 0.64
R7237:Pcdh15 UTSW 10 74584191 missense possibly damaging 0.88
R7266:Pcdh15 UTSW 10 74379390 nonsense probably null
R7276:Pcdh15 UTSW 10 74324392 missense probably benign 0.25
R7359:Pcdh15 UTSW 10 74584216 missense probably damaging 0.99
R7396:Pcdh15 UTSW 10 74630690 missense probably benign 0.17
R7421:Pcdh15 UTSW 10 74454065 missense possibly damaging 0.90
R7424:Pcdh15 UTSW 10 74506485 missense probably benign 0.09
R7463:Pcdh15 UTSW 10 74631770 missense possibly damaging 0.66
R7469:Pcdh15 UTSW 10 74645980 missense probably benign
R7512:Pcdh15 UTSW 10 74641382 missense possibly damaging 0.81
R7767:Pcdh15 UTSW 10 74486256 missense probably benign 0.07
R7830:Pcdh15 UTSW 10 74385901 missense probably damaging 1.00
RF020:Pcdh15 UTSW 10 74185410 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATGTGCCCCTGAACAC -3'
(R):5'- AGCAGATCATTCGAAGTGTTAGG -3'

Sequencing Primer
(F):5'- ACACACTGTTCAAGGGGC -3'
(R):5'- GGTTGTGCACATGTGATAAACCCC -3'
Posted On2018-11-28