Mutagenetix > Incidental Mutation

Incidental Mutation 'R6954:Zfp280b'

541378

Institutional Source

Beutler Lab

Gene Symbol

Zfp280b

Ensembl Gene

ENSMUSG00000049764

Gene Name

zinc finger protein 280B

Synonyms

Suhw2, D10Jhu82e

MMRRC Submission

045066-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R6954 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76032650-76043234 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76039688 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 467 (M467K)

Ref Sequence

ENSEMBL: ENSMUSP00000056340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061617] [ENSMUST00000218627]

AlphaFold

Q505F4

Predicted Effect

probably benign
Transcript: ENSMUST00000061617
AA Change: M467K

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000056340
Gene: ENSMUSG00000049764
AA Change: M467K

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	29	37	N/A	INTRINSIC
Pfam:DUF4195	53	227	1.3e-38	PFAM
ZnF_C2H2	297	318	3.65e1	SMART
ZnF_C2H2	334	357	9.46e0	SMART
ZnF_C2H2	364	387	8.22e-2	SMART
ZnF_C2H2	394	417	4.23e0	SMART
ZnF_C2H2	423	445	1.72e1	SMART
ZnF_C2H2	451	474	2.12e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218627

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that upregulates expression of MDM2, which negatively regulates p53 expression. This gene is highly expressed in prostate cancer cells, which leads to a reduction in p53 levels and an increase in growth of the cancer cells. Several transcript variants have been found for this gene, but only one of them is protein-coding. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	T	A	11: 58,608,488	Y168F	probably benign	Het
4930451I11Rik	A	T	7: 126,830,637		probably null	Het
Alox5	A	C	6: 116,420,280	Y314*	probably null	Het
Ap4e1	T	C	2: 127,064,951	S1044P	probably benign	Het
Ash2l	A	G	8: 25,822,768	V391A	possibly damaging	Het
B4galnt4	A	G	7: 141,067,232	T326A	probably benign	Het
Ccm2	T	A	11: 6,594,239	I345N	probably damaging	Het
Cntnap3	G	A	13: 64,748,559	H1034Y	probably benign	Het
Cpsf1	A	G	15: 76,599,496	L849S	probably damaging	Het
Ctrb1	A	G	8: 111,686,664	S239P	probably damaging	Het
D13Ertd608e	A	G	13: 119,846,130	D20G	possibly damaging	Het
Dennd1b	T	A	1: 139,168,945		probably benign	Het
Dnah17	A	G	11: 118,066,432	I2773T	probably damaging	Het
Eif2b2	T	A	12: 85,226,043	F267L	probably damaging	Het
Fcrls	A	G	3: 87,263,676		probably benign	Het
Furin	G	T	7: 80,396,964	D181E	possibly damaging	Het
Gm29106	T	A	1: 118,200,587	C670S	probably damaging	Het
Gm6309	A	T	5: 146,168,490	D204E	possibly damaging	Het
Hsf2	T	A	10: 57,504,643	I191N	probably damaging	Het
Hspa12a	T	C	19: 58,799,692	D566G	probably benign	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Igfbpl1	C	T	4: 45,826,663	C44Y	probably damaging	Het
Letm1	G	A	5: 33,782,507	R16C	probably benign	Het
Marf1	A	G	16: 14,138,520	V819A	probably damaging	Het
Mfsd4b4	A	T	10: 39,891,952	S428T	probably benign	Het
Myo1d	T	C	11: 80,674,957	I347M	probably benign	Het
Myo9b	A	G	8: 71,290,819	I175V	probably damaging	Het
Naip5	A	T	13: 100,223,414	V438E	probably damaging	Het
Nup205	T	A	6: 35,208,109	V768E	possibly damaging	Het
Olfr1015	T	A	2: 85,786,382	Y290*	probably null	Het
Olfr731	A	T	14: 50,238,110	Y258*	probably null	Het
Pcdh15	C	T	10: 74,645,989	H1651Y	possibly damaging	Het
Pdgfra	A	T	5: 75,173,394	Q376L	possibly damaging	Het
Pign	T	C	1: 105,553,897	I791M	probably benign	Het
Pik3c2b	T	G	1: 133,066,303	S2A	possibly damaging	Het
Pip5k1a	A	T	3: 95,068,247	I304K	probably damaging	Het
Pkdrej	A	T	15: 85,817,853	L1294*	probably null	Het
Pprc1	T	C	19: 46,064,433	S797P	probably damaging	Het
Prob1	A	G	18: 35,654,268	V311A	probably benign	Het
Prune2	C	A	19: 17,000,021	T40K	probably damaging	Het
Rif1	T	G	2: 52,112,691	D2052E	probably benign	Het
Sall1	A	G	8: 89,032,891	V195A	probably damaging	Het
Scfd1	T	C	12: 51,427,946		probably null	Het
Sidt2	A	T	9: 45,952,850	N123K	probably benign	Het
Slc22a6	G	A	19: 8,622,096	A320T	probably benign	Het
Slc25a10	A	G	11: 120,498,147	H279R	probably benign	Het
Slc35b4	A	G	6: 34,158,621	V252A	probably benign	Het
Slc46a3	T	C	5: 147,886,340	T231A	probably benign	Het
Stxbp1	T	A	2: 32,801,893	H429L	probably damaging	Het
Tas2r134	C	T	2: 51,627,770	T87I	probably benign	Het
Tdpoz2	A	T	3: 93,652,275	L130H	probably damaging	Het
Tmem69	T	C	4: 116,554,724		probably null	Het
Tmppe	G	A	9: 114,405,523	V297I	probably benign	Het
Ung	G	T	5: 114,131,337	A37S	probably benign	Het
Vdac1	T	C	11: 52,386,373	Y237H	probably damaging	Het
Vgll4	T	C	6: 114,921,367	Y11C	probably damaging	Het
Vmn1r24	A	G	6: 57,956,452	I27T	probably benign	Het
Zkscan4	A	G	13: 21,484,365	I329V	probably damaging	Het

Other mutations in Zfp280b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01394:Zfp280b	APN	10	76039663	missense	probably damaging	0.99
IGL02016:Zfp280b	APN	10	76039111	missense	possibly damaging	0.68
IGL02245:Zfp280b	APN	10	76039363	missense	probably benign
IGL03233:Zfp280b	APN	10	76039769	missense	probably damaging	1.00
R0864:Zfp280b	UTSW	10	76038305	missense	probably benign	0.00
R1501:Zfp280b	UTSW	10	76039769	missense	probably damaging	1.00
R1643:Zfp280b	UTSW	10	76039610	missense	probably damaging	1.00
R2004:Zfp280b	UTSW	10	76038536	missense	probably benign	0.00
R2024:Zfp280b	UTSW	10	76038494	missense	probably damaging	1.00
R2025:Zfp280b	UTSW	10	76038494	missense	probably damaging	1.00
R2027:Zfp280b	UTSW	10	76038494	missense	probably damaging	1.00
R2064:Zfp280b	UTSW	10	76039183	missense	probably damaging	1.00
R3729:Zfp280b	UTSW	10	76039102	missense	probably benign	0.33
R4634:Zfp280b	UTSW	10	76038829	missense	probably benign	0.00
R4812:Zfp280b	UTSW	10	76039090	missense	probably benign	0.24
R4968:Zfp280b	UTSW	10	76039354	missense	probably damaging	1.00
R5007:Zfp280b	UTSW	10	76039214	missense	probably damaging	1.00
R5123:Zfp280b	UTSW	10	76039349	missense	probably benign	0.02
R5503:Zfp280b	UTSW	10	76039462	splice site	probably null
R5552:Zfp280b	UTSW	10	76039663	nonsense	probably null
R7299:Zfp280b	UTSW	10	76038703	missense	probably damaging	0.98
R7301:Zfp280b	UTSW	10	76038703	missense	probably damaging	0.98
R7485:Zfp280b	UTSW	10	76039241	missense	probably damaging	1.00
R9170:Zfp280b	UTSW	10	76038817	missense	probably benign	0.22
R9346:Zfp280b	UTSW	10	76039292	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- GTAAGTACAGGTCGTCAGGC -3'
(R):5'- TTCTGTGAAAGTCTGCCTTGAG -3'

Sequencing Primer
(F):5'- TACAGGTCGTCAGGCTTCGC -3'
(R):5'- AAAGTCTGCCTTGAGGTCGG -3'

Posted On

2018-11-28