Incidental Mutation 'R6954:Igf1'
ID541379
Institutional Source Beutler Lab
Gene Symbol Igf1
Ensembl Gene ENSMUSG00000020053
Gene Nameinsulin-like growth factor 1
SynonymsC730016P09Rik, Igf-I, Igf-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location87858265-87937042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 87864860 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 49 (V49L)
Ref Sequence ENSEMBL: ENSMUSP00000113177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062862] [ENSMUST00000095360] [ENSMUST00000105300] [ENSMUST00000121161] [ENSMUST00000121952] [ENSMUST00000122100] [ENSMUST00000122386] [ENSMUST00000126490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062862
AA Change: V49L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056668
Gene: ENSMUSG00000020053
AA Change: V49L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095360
AA Change: V65L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093005
Gene: ENSMUSG00000020053
AA Change: V65L

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105300
AA Change: V65L

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100937
Gene: ENSMUSG00000020053
AA Change: V65L

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121161
AA Change: V49L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114120
Gene: ENSMUSG00000020053
AA Change: V49L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121952
AA Change: V49L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113177
Gene: ENSMUSG00000020053
AA Change: V49L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122100
AA Change: V49L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112878
Gene: ENSMUSG00000020053
AA Change: V49L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122386
AA Change: V65L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113905
Gene: ENSMUSG00000020053
AA Change: V65L

DomainStartEndE-ValueType
IlGF 51 109 9.22e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126490
AA Change: V49L

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122188
Gene: ENSMUSG00000020053
AA Change: V49L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IlGF 35 93 9.22e-24 SMART
Meta Mutation Damage Score 0.5482 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the insulin-like growth factor (IGF) family of proteins that promote growth and development during fetal and postnatal life. This gene is predominantly expressed in the liver and the encoded protein undergoes proteolytic processing to generate a disulfide-linked mature polypeptide. Transgenic disruption of this gene in mice results in reduced postnatal survival and severe growth retardation. Mice lacking the encoded protein exhibit generalized organ hypoplasia including underdevelopment of the central nervous system and developmental defects in bone, muscle and reproductive systems. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are severely growth retarded and die perinatally with many immature organ systems. Heterozygotes and partial knockouts show genetic background effects and can display growth retardation and abnormalities in muscle, lungs, and CNS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Igf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02485:Igf1 APN 10 87864746 missense probably benign
IGL03171:Igf1 APN 10 87864821 missense probably damaging 1.00
R1850:Igf1 UTSW 10 87861374 missense possibly damaging 0.47
R1962:Igf1 UTSW 10 87864864 missense probably damaging 1.00
R2428:Igf1 UTSW 10 87864821 missense probably damaging 1.00
R3852:Igf1 UTSW 10 87915319 nonsense probably null
R4757:Igf1 UTSW 10 87915425 missense probably benign 0.01
R6893:Igf1 UTSW 10 87864860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCCAGAAGGATACCTG -3'
(R):5'- ATGCCCCACTGAAGTGTTATG -3'

Sequencing Primer
(F):5'- CAGAAGGATACCTGAACCTCC -3'
(R):5'- GCCCCACTGAAGTGTTATGCATAC -3'
Posted On2018-11-28