Mutagenetix > Incidental Mutation

Incidental Mutation 'R6954:Dnah17'

541383

Institutional Source

Beutler Lab

Gene Symbol

Dnah17

Ensembl Gene

ENSMUSG00000033987

Gene Name

dynein, axonemal, heavy chain 17

Synonyms

LOC382552, Dnahcl1, 2810003K23Rik, Dnahc17

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6954 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118021723-118130634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118066432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 2773 (I2773T)

Ref Sequence

ENSEMBL: ENSMUSP00000101915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084803
AA Change: I2773T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: I2773T

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	183	766	8.5e-142	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1260	1673	5.8e-135	PFAM
Pfam:AAA_6	1793	2023	6e-161	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	7.8e-13	PFAM
Pfam:AAA_7	2400	2671	1.1e-171	PFAM
Pfam:AAA_8	2748	3015	4.9e-166	PFAM
Pfam:MT	3027	3370	3.4e-214	PFAM
Pfam:AAA_9	3388	3615	2.4e-144	PFAM
Pfam:Dynein_heavy	3742	4452	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106308
AA Change: I2773T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: I2773T

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	184	764	1.7e-152	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1262	1671	4.1e-132	PFAM
Pfam:AAA_6	1793	2023	7e-149	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	2.5e-11	PFAM
Pfam:AAA_7	2400	2671	4.4e-169	PFAM
Pfam:AAA_8	2748	3015	7.1e-163	PFAM
Pfam:MT	3027	3370	1.1e-210	PFAM
Pfam:AAA_9	3392	3614	1e-84	PFAM
Pfam:Dynein_heavy	3748	4479	3.5e-230	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: I2786T

Domain	Start	End	E-Value	Type
Pfam:DHC_N2	279	688	3.1e-132	PFAM
Pfam:AAA_6	811	1041	5.3e-149	PFAM
low complexity region	1110	1122	N/A	INTRINSIC
Blast:AAA	1123	1354	1e-104	BLAST
Pfam:AAA_7	1452	1671	8.9e-134	PFAM
Pfam:AAA_8	1763	2030	5.4e-163	PFAM
Pfam:MT	2042	2168	6.8e-52	PFAM
Pfam:MT	2163	2412	8.2e-149	PFAM
Pfam:AAA_9	2434	2656	7.9e-85	PFAM
Pfam:Dynein_heavy	2790	3457	2.6e-209	PFAM
Pfam:Dynein_heavy	3460	3569	4.6e-17	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	T	A	11: 58,608,488	Y168F	probably benign	Het
4930451I11Rik	A	T	7: 126,830,637		probably null	Het
Alox5	A	C	6: 116,420,280	Y314*	probably null	Het
Ap4e1	T	C	2: 127,064,951	S1044P	probably benign	Het
Ash2l	A	G	8: 25,822,768	V391A	possibly damaging	Het
B4galnt4	A	G	7: 141,067,232	T326A	probably benign	Het
Ccm2	T	A	11: 6,594,239	I345N	probably damaging	Het
Cntnap3	G	A	13: 64,748,559	H1034Y	probably benign	Het
Cpsf1	A	G	15: 76,599,496	L849S	probably damaging	Het
Ctrb1	A	G	8: 111,686,664	S239P	probably damaging	Het
D13Ertd608e	A	G	13: 119,846,130	D20G	possibly damaging	Het
Dennd1b	T	A	1: 139,168,945		probably benign	Het
Eif2b2	T	A	12: 85,226,043	F267L	probably damaging	Het
Fcrls	A	G	3: 87,263,676		probably benign	Het
Furin	G	T	7: 80,396,964	D181E	possibly damaging	Het
Gm29106	T	A	1: 118,200,587	C670S	probably damaging	Het
Gm6309	A	T	5: 146,168,490	D204E	possibly damaging	Het
Hsf2	T	A	10: 57,504,643	I191N	probably damaging	Het
Hspa12a	T	C	19: 58,799,692	D566G	probably benign	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Igfbpl1	C	T	4: 45,826,663	C44Y	probably damaging	Het
Letm1	G	A	5: 33,782,507	R16C	probably benign	Het
Marf1	A	G	16: 14,138,520	V819A	probably damaging	Het
Mfsd4b4	A	T	10: 39,891,952	S428T	probably benign	Het
Myo1d	T	C	11: 80,674,957	I347M	probably benign	Het
Myo9b	A	G	8: 71,290,819	I175V	probably damaging	Het
Naip5	A	T	13: 100,223,414	V438E	probably damaging	Het
Nup205	T	A	6: 35,208,109	V768E	possibly damaging	Het
Olfr1015	T	A	2: 85,786,382	Y290*	probably null	Het
Olfr731	A	T	14: 50,238,110	Y258*	probably null	Het
Pcdh15	C	T	10: 74,645,989	H1651Y	possibly damaging	Het
Pdgfra	A	T	5: 75,173,394	Q376L	possibly damaging	Het
Pign	T	C	1: 105,553,897	I791M	probably benign	Het
Pik3c2b	T	G	1: 133,066,303	S2A	possibly damaging	Het
Pip5k1a	A	T	3: 95,068,247	I304K	probably damaging	Het
Pkdrej	A	T	15: 85,817,853	L1294*	probably null	Het
Pprc1	T	C	19: 46,064,433	S797P	probably damaging	Het
Prob1	A	G	18: 35,654,268	V311A	probably benign	Het
Prune2	C	A	19: 17,000,021	T40K	probably damaging	Het
Rif1	T	G	2: 52,112,691	D2052E	probably benign	Het
Sall1	A	G	8: 89,032,891	V195A	probably damaging	Het
Scfd1	T	C	12: 51,427,946		probably null	Het
Sidt2	A	T	9: 45,952,850	N123K	probably benign	Het
Slc22a6	G	A	19: 8,622,096	A320T	probably benign	Het
Slc25a10	A	G	11: 120,498,147	H279R	probably benign	Het
Slc35b4	A	G	6: 34,158,621	V252A	probably benign	Het
Slc46a3	T	C	5: 147,886,340	T231A	probably benign	Het
Stxbp1	T	A	2: 32,801,893	H429L	probably damaging	Het
Tas2r134	C	T	2: 51,627,770	T87I	probably benign	Het
Tdpoz2	A	T	3: 93,652,275	L130H	probably damaging	Het
Tmem69	T	C	4: 116,554,724		probably null	Het
Tmppe	G	A	9: 114,405,523	V297I	probably benign	Het
Ung	G	T	5: 114,131,337	A37S	probably benign	Het
Vdac1	T	C	11: 52,386,373	Y237H	probably damaging	Het
Vgll4	T	C	6: 114,921,367	Y11C	probably damaging	Het
Vmn1r24	A	G	6: 57,956,452	I27T	probably benign	Het
Zfp280b	T	A	10: 76,039,688	M467K	probably benign	Het
Zkscan4	A	G	13: 21,484,365	I329V	probably damaging	Het

Other mutations in Dnah17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Dnah17	APN	11	118088214	missense	possibly damaging	0.81
IGL00531:Dnah17	APN	11	118043173	missense	probably damaging	0.97
IGL00764:Dnah17	APN	11	118096485	missense	probably damaging	0.99
IGL00795:Dnah17	APN	11	118093634	missense	probably benign	0.35
IGL00823:Dnah17	APN	11	118047161	missense	probably benign	0.22
IGL01145:Dnah17	APN	11	118047173	missense	possibly damaging	0.63
IGL01433:Dnah17	APN	11	118049934	missense	probably damaging	1.00
IGL01454:Dnah17	APN	11	118058397	missense	probably damaging	1.00
IGL01545:Dnah17	APN	11	118119568	missense	probably damaging	1.00
IGL01548:Dnah17	APN	11	118098612	missense	probably benign	0.21
IGL01557:Dnah17	APN	11	118073686	missense	probably damaging	0.98
IGL01632:Dnah17	APN	11	118033881	missense	probably damaging	1.00
IGL01636:Dnah17	APN	11	118041056	missense	probably benign	0.03
IGL01672:Dnah17	APN	11	118042160	missense	probably damaging	0.97
IGL01822:Dnah17	APN	11	118081993	missense	probably damaging	1.00
IGL01869:Dnah17	APN	11	118052676	missense	probably benign	0.09
IGL01916:Dnah17	APN	11	118125288	missense	probably benign	0.00
IGL02131:Dnah17	APN	11	118072908	missense	probably damaging	1.00
IGL02154:Dnah17	APN	11	118124261	missense	probably benign	0.01
IGL02220:Dnah17	APN	11	118072967	nonsense	probably null
IGL02454:Dnah17	APN	11	118080767	missense	probably damaging	0.98
IGL02458:Dnah17	APN	11	118036350	missense	probably damaging	1.00
IGL02588:Dnah17	APN	11	118025653	missense	possibly damaging	0.95
IGL02865:Dnah17	APN	11	118073548	missense	probably damaging	1.00
IGL02881:Dnah17	APN	11	118042118	missense	probably damaging	1.00
IGL02952:Dnah17	APN	11	118088268	missense	probably benign	0.03
IGL03382:Dnah17	APN	11	118081943	missense	probably damaging	1.00
IGL03389:Dnah17	APN	11	118094979	missense	probably damaging	1.00
ergos	UTSW	11	118041158	splice site	probably benign
watt	UTSW	11	118080766	missense	probably damaging	0.96
PIT4280001:Dnah17	UTSW	11	118098582	missense	possibly damaging	0.85
R0004:Dnah17	UTSW	11	118060092	missense	possibly damaging	0.90
R0112:Dnah17	UTSW	11	118074434	missense	possibly damaging	0.82
R0116:Dnah17	UTSW	11	118058306	missense	probably benign	0.01
R0157:Dnah17	UTSW	11	118127171	missense	probably benign
R0320:Dnah17	UTSW	11	118052674	missense	possibly damaging	0.56
R0362:Dnah17	UTSW	11	118098539	missense	probably benign	0.10
R0382:Dnah17	UTSW	11	118128996	missense	probably damaging	1.00
R0383:Dnah17	UTSW	11	118067547	missense	probably benign
R0400:Dnah17	UTSW	11	118082078	missense	probably damaging	1.00
R0420:Dnah17	UTSW	11	118039939	missense	probably damaging	1.00
R0483:Dnah17	UTSW	11	118047124	missense	probably benign
R0533:Dnah17	UTSW	11	118110537	missense	possibly damaging	0.50
R0562:Dnah17	UTSW	11	118072900	missense	probably damaging	1.00
R0564:Dnah17	UTSW	11	118082981	missense	probably damaging	1.00
R0604:Dnah17	UTSW	11	118121471	missense	probably benign	0.00
R0608:Dnah17	UTSW	11	118090749	nonsense	probably null
R0614:Dnah17	UTSW	11	118070568	splice site	probably benign
R0632:Dnah17	UTSW	11	118067682	splice site	probably benign
R0831:Dnah17	UTSW	11	118060271	missense	probably damaging	0.99
R0838:Dnah17	UTSW	11	118060104	missense	probably damaging	1.00
R0879:Dnah17	UTSW	11	118056835	splice site	probably benign
R1061:Dnah17	UTSW	11	118052688	missense	possibly damaging	0.51
R1190:Dnah17	UTSW	11	118042175	missense	probably damaging	1.00
R1293:Dnah17	UTSW	11	118127137	critical splice donor site	probably null
R1297:Dnah17	UTSW	11	118121366	splice site	probably benign
R1332:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1336:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1364:Dnah17	UTSW	11	118125606	splice site	probably benign
R1418:Dnah17	UTSW	11	118074023	missense	probably damaging	0.98
R1432:Dnah17	UTSW	11	118023327	missense	probably damaging	1.00
R1497:Dnah17	UTSW	11	118114233	missense	probably damaging	1.00
R1500:Dnah17	UTSW	11	118101053	missense	probably benign
R1506:Dnah17	UTSW	11	118125387	missense	possibly damaging	0.53
R1512:Dnah17	UTSW	11	118095015	missense	probably benign
R1567:Dnah17	UTSW	11	118125985	missense	probably damaging	1.00
R1597:Dnah17	UTSW	11	118103498	splice site	probably benign
R1665:Dnah17	UTSW	11	118121495	splice site	probably benign
R1703:Dnah17	UTSW	11	118026749	missense	probably damaging	1.00
R1716:Dnah17	UTSW	11	118032598	missense	probably benign	0.00
R1727:Dnah17	UTSW	11	118070489	missense	probably damaging	0.98
R1727:Dnah17	UTSW	11	118096536	nonsense	probably null
R1728:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1784:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1852:Dnah17	UTSW	11	118121916	missense	probably damaging	0.97
R1869:Dnah17	UTSW	11	118047189	nonsense	probably null
R1886:Dnah17	UTSW	11	118108161	missense	possibly damaging	0.62
R1893:Dnah17	UTSW	11	118066968	missense	probably benign	0.00
R1954:Dnah17	UTSW	11	118024731	missense	probably damaging	1.00
R1969:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1971:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1975:Dnah17	UTSW	11	118096536	nonsense	probably null
R1977:Dnah17	UTSW	11	118112591	missense	possibly damaging	0.52
R2055:Dnah17	UTSW	11	118067531	missense	probably benign	0.00
R2115:Dnah17	UTSW	11	118119802	missense	probably benign	0.00
R2132:Dnah17	UTSW	11	118033747	missense	probably damaging	0.98
R2200:Dnah17	UTSW	11	118102409	splice site	probably benign
R2277:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2279:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2400:Dnah17	UTSW	11	118126384	critical splice acceptor site	probably null
R2402:Dnah17	UTSW	11	118125974	missense	probably benign	0.10
R2497:Dnah17	UTSW	11	118087024	splice site	probably null
R2923:Dnah17	UTSW	11	118093547	missense	probably damaging	1.00
R3121:Dnah17	UTSW	11	118041086	missense	probably damaging	1.00
R3236:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3237:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3498:Dnah17	UTSW	11	118080849	splice site	probably benign
R3499:Dnah17	UTSW	11	118080849	splice site	probably benign
R3746:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3749:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3762:Dnah17	UTSW	11	118104526	missense	probably benign	0.00
R3826:Dnah17	UTSW	11	118041158	splice site	probably benign
R3828:Dnah17	UTSW	11	118041158	splice site	probably benign
R3829:Dnah17	UTSW	11	118041158	splice site	probably benign
R3877:Dnah17	UTSW	11	118024707	missense	probably damaging	1.00
R3899:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3900:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3911:Dnah17	UTSW	11	118080849	splice site	probably benign
R3913:Dnah17	UTSW	11	118080849	splice site	probably benign
R3930:Dnah17	UTSW	11	118080849	splice site	probably benign
R3931:Dnah17	UTSW	11	118080849	splice site	probably benign
R3969:Dnah17	UTSW	11	118041158	splice site	probably benign
R3970:Dnah17	UTSW	11	118041158	splice site	probably benign
R4056:Dnah17	UTSW	11	118070538	missense	probably benign	0.05
R4113:Dnah17	UTSW	11	118112594	missense	possibly damaging	0.50
R4295:Dnah17	UTSW	11	118118772	missense	probably damaging	1.00
R4324:Dnah17	UTSW	11	118094213	missense	probably benign	0.01
R4412:Dnah17	UTSW	11	118073683	missense	probably damaging	1.00
R4413:Dnah17	UTSW	11	118025168	missense	probably benign	0.00
R4422:Dnah17	UTSW	11	118081973	missense	possibly damaging	0.91
R4552:Dnah17	UTSW	11	118052943	missense	possibly damaging	0.79
R4669:Dnah17	UTSW	11	118074293	missense	probably benign	0.02
R4677:Dnah17	UTSW	11	118119814	missense	probably damaging	1.00
R4716:Dnah17	UTSW	11	118073648	missense	probably benign	0.02
R4832:Dnah17	UTSW	11	118026780	missense	probably damaging	1.00
R4868:Dnah17	UTSW	11	118108212	missense	probably benign	0.03
R4897:Dnah17	UTSW	11	118078593	missense	probably damaging	1.00
R4928:Dnah17	UTSW	11	118027433	missense	probably damaging	1.00
R4937:Dnah17	UTSW	11	118042154	missense	probably damaging	1.00
R4957:Dnah17	UTSW	11	118074298	missense	probably benign	0.44
R5008:Dnah17	UTSW	11	118110577	missense	probably benign	0.01
R5016:Dnah17	UTSW	11	118080766	missense	probably damaging	0.96
R5027:Dnah17	UTSW	11	118102539	missense	probably benign	0.01
R5133:Dnah17	UTSW	11	118117113	missense	probably benign	0.00
R5140:Dnah17	UTSW	11	118086945	missense	probably damaging	1.00
R5146:Dnah17	UTSW	11	118114179	missense	probably damaging	0.99
R5151:Dnah17	UTSW	11	118027467	missense	probably damaging	1.00
R5153:Dnah17	UTSW	11	118082974	nonsense	probably null
R5192:Dnah17	UTSW	11	118034359	missense	possibly damaging	0.96
R5315:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5317:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5335:Dnah17	UTSW	11	118112514	missense	probably damaging	1.00
R5379:Dnah17	UTSW	11	118117203	intron	probably benign
R5396:Dnah17	UTSW	11	118127282	missense	probably benign
R5418:Dnah17	UTSW	11	118094984	missense	probably benign	0.04
R5534:Dnah17	UTSW	11	118052770	missense	possibly damaging	0.83
R5539:Dnah17	UTSW	11	118073660	missense	probably benign	0.03
R5594:Dnah17	UTSW	11	118043229	splice site	probably null
R5634:Dnah17	UTSW	11	118052926	splice site	probably null
R5696:Dnah17	UTSW	11	118101056	missense	probably benign	0.44
R5802:Dnah17	UTSW	11	118036446	missense	possibly damaging	0.79
R5826:Dnah17	UTSW	11	118034367	missense	probably damaging	1.00
R5873:Dnah17	UTSW	11	118056897	missense	probably benign	0.01
R5898:Dnah17	UTSW	11	118114213	missense	probably benign	0.00
R5934:Dnah17	UTSW	11	118041102	missense	probably benign
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6113:Dnah17	UTSW	11	118126275	missense	probably damaging	1.00
R6117:Dnah17	UTSW	11	118119571	missense	probably benign	0.00
R6137:Dnah17	UTSW	11	118025654	missense	probably damaging	1.00
R6173:Dnah17	UTSW	11	118039946	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126323	nonsense	probably null
R6258:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126323	nonsense	probably null
R6260:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6278:Dnah17	UTSW	11	118126290	missense	probably damaging	0.99
R6298:Dnah17	UTSW	11	118108161	missense	probably benign	0.00
R6300:Dnah17	UTSW	11	118034310	missense	probably damaging	1.00
R6302:Dnah17	UTSW	11	118129155	missense	probably benign	0.09
R6363:Dnah17	UTSW	11	118110505	missense	probably benign
R6381:Dnah17	UTSW	11	118129185	missense	probably benign	0.08
R6418:Dnah17	UTSW	11	118129197	missense	probably damaging	0.99
R6660:Dnah17	UTSW	11	118100188	missense	probably benign
R6803:Dnah17	UTSW	11	118125372	missense	probably benign	0.00
R6820:Dnah17	UTSW	11	118069000	missense	probably damaging	0.99
R6885:Dnah17	UTSW	11	118090772	missense	possibly damaging	0.47
R6921:Dnah17	UTSW	11	118041484	missense	probably damaging	0.98
R6932:Dnah17	UTSW	11	118060079	missense	possibly damaging	0.95
R7000:Dnah17	UTSW	11	118025702	critical splice acceptor site	probably null
R7007:Dnah17	UTSW	11	118118871	missense	possibly damaging	0.92
R7048:Dnah17	UTSW	11	118046118	missense	possibly damaging	0.80
R7056:Dnah17	UTSW	11	118125386	missense	probably benign
R7131:Dnah17	UTSW	11	118079658	missense	probably benign	0.14
R7143:Dnah17	UTSW	11	118086130	missense	probably damaging	1.00
R7146:Dnah17	UTSW	11	118082110	missense	probably damaging	0.98
R7147:Dnah17	UTSW	11	118094929	missense	probably benign	0.31
R7172:Dnah17	UTSW	11	118041131	nonsense	probably null
R7183:Dnah17	UTSW	11	118129188	missense	probably benign
R7297:Dnah17	UTSW	11	118055730	critical splice donor site	probably null
R7297:Dnah17	UTSW	11	118103356	missense	probably damaging	0.98
R7367:Dnah17	UTSW	11	118115196	missense	probably benign
R7398:Dnah17	UTSW	11	118080724	missense	probably damaging	0.96
R7426:Dnah17	UTSW	11	118090717	missense	probably null	0.79
R7524:Dnah17	UTSW	11	118121481	missense	probably benign	0.03
R7529:Dnah17	UTSW	11	118049866	critical splice donor site	probably null
R7615:Dnah17	UTSW	11	118110547	nonsense	probably null
R7681:Dnah17	UTSW	11	118025186	missense	probably damaging	1.00
R7702:Dnah17	UTSW	11	118025640	missense	probably benign	0.00
R7702:Dnah17	UTSW	11	118121478	missense	possibly damaging	0.64
R7713:Dnah17	UTSW	11	118025171	missense	probably benign	0.02
R7809:Dnah17	UTSW	11	118104636	missense	probably benign	0.09
R7842:Dnah17	UTSW	11	118079682	critical splice acceptor site	probably null
R7935:Dnah17	UTSW	11	118127222	missense	probably benign	0.20
R7951:Dnah17	UTSW	11	118118766	missense	possibly damaging	0.64
R8070:Dnah17	UTSW	11	118024671	missense	probably damaging	0.97
R8098:Dnah17	UTSW	11	118050367	missense	probably damaging	1.00
R8101:Dnah17	UTSW	11	118125918	missense	probably benign
R8177:Dnah17	UTSW	11	118128927	missense	possibly damaging	0.60
R8343:Dnah17	UTSW	11	118114195	missense	probably benign
R8350:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8393:Dnah17	UTSW	11	118057029	missense	probably damaging	1.00
R8401:Dnah17	UTSW	11	118024659	missense	probably damaging	0.96
R8418:Dnah17	UTSW	11	118103458	missense	probably benign	0.01
R8450:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8546:Dnah17	UTSW	11	118124275	missense	probably benign	0.00
R8697:Dnah17	UTSW	11	118086159	missense	possibly damaging	0.96
R8710:Dnah17	UTSW	11	118042147	missense	probably damaging	1.00
R8713:Dnah17	UTSW	11	118088202	missense	probably damaging	1.00
R8722:Dnah17	UTSW	11	118070457	nonsense	probably null
R8797:Dnah17	UTSW	11	118101375	missense	probably benign	0.00
R8953:Dnah17	UTSW	11	118125412	splice site	probably benign
R8965:Dnah17	UTSW	11	118024666	missense	probably damaging	1.00
R8976:Dnah17	UTSW	11	118026840	missense	probably damaging	1.00
R9090:Dnah17	UTSW	11	118041044	missense	probably damaging	1.00
R9128:Dnah17	UTSW	11	118046178	missense	possibly damaging	0.76
R9134:Dnah17	UTSW	11	118088146	missense	probably damaging	1.00
R9245:Dnah17	UTSW	11	118125677	missense	probably benign	0.02
R9251:Dnah17	UTSW	11	118121792	missense	probably benign	0.03
R9271:Dnah17	UTSW	11	118041044	missense	probably damaging	1.00
R9367:Dnah17	UTSW	11	118096638	missense	possibly damaging	0.95
R9367:Dnah17	UTSW	11	118121386	missense	possibly damaging	0.93
R9381:Dnah17	UTSW	11	118023393	missense	probably benign
R9405:Dnah17	UTSW	11	118118911	missense	probably benign
R9449:Dnah17	UTSW	11	118096626	missense	probably benign	0.07
R9517:Dnah17	UTSW	11	118024614	missense	possibly damaging	0.76
R9588:Dnah17	UTSW	11	118121957	missense	probably benign	0.00
R9629:Dnah17	UTSW	11	118088978	missense	probably damaging	1.00
R9654:Dnah17	UTSW	11	118036330	critical splice donor site	probably null
R9655:Dnah17	UTSW	11	118080823	missense	possibly damaging	0.94
R9662:Dnah17	UTSW	11	118034340	missense	probably damaging	0.97
R9686:Dnah17	UTSW	11	118088222	missense	possibly damaging	0.46
R9689:Dnah17	UTSW	11	118072905	missense	probably damaging	1.00
R9706:Dnah17	UTSW	11	118126200	missense	probably damaging	1.00
X0058:Dnah17	UTSW	11	118082925	missense	probably damaging	1.00
Z1176:Dnah17	UTSW	11	118127166	missense	probably benign	0.01
Z1177:Dnah17	UTSW	11	118078563	missense	possibly damaging	0.91
Z1177:Dnah17	UTSW	11	118086960	missense	probably damaging	1.00
Z1177:Dnah17	UTSW	11	118127142	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GACACGCTGCTTTGCTCTTG -3'
(R):5'- GCGATGACCTCTGAGCATAAG -3'

Sequencing Primer
(F):5'- ATCCTGGCCCTTTTTGGAG -3'
(R):5'- ACCTCTGAGCATAAGTGACTGGTC -3'

Posted On

2018-11-28