Mutagenetix > Incidental Mutations

Incidental Mutation 'R6954:Cpsf1'

541392

Institutional Source

Beutler Lab

Gene Symbol

Cpsf1

Ensembl Gene

ENSMUSG00000034022

Gene Name

cleavage and polyadenylation specific factor 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R6954 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76595803-76607591 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76599496 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 849 (L849S)

Ref Sequence

ENSEMBL: ENSMUSP00000155308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000160784] [ENSMUST00000161612] [ENSMUST00000161732] [ENSMUST00000162503] [ENSMUST00000230157] [ENSMUST00000231042]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071898
AA Change: L849S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: L849S

Domain	Start	End	E-Value	Type
Pfam:MMS1_N	92	684	7.2e-42	PFAM
low complexity region	902	910	N/A	INTRINSIC
Pfam:CPSF_A	1071	1407	4.9e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160784

SMART Domains

Protein: ENSMUSP00000124666
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC
Pfam:ABC1	188	304	9.2e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161612

SMART Domains

Protein: ENSMUSP00000124701
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161732

SMART Domains

Protein: ENSMUSP00000125482
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162503

SMART Domains

Protein: ENSMUSP00000125055
Gene: ENSMUSG00000022550

Domain	Start	End	E-Value	Type
transmembrane domain	50	69	N/A	INTRINSIC
Pfam:ABC1	188	304	2.3e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229287

Predicted Effect

probably damaging
Transcript: ENSMUST00000230157
AA Change: L849S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000231042

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

98% (57/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210407C18Rik	T	A	11: 58,608,488	Y168F	probably benign	Het
4930451I11Rik	A	T	7: 126,830,637		probably null	Het
Alox5	A	C	6: 116,420,280	Y314*	probably null	Het
Ap4e1	T	C	2: 127,064,951	S1044P	probably benign	Het
Ash2l	A	G	8: 25,822,768	V391A	possibly damaging	Het
B4galnt4	A	G	7: 141,067,232	T326A	probably benign	Het
Ccm2	T	A	11: 6,594,239	I345N	probably damaging	Het
Cntnap3	G	A	13: 64,748,559	H1034Y	probably benign	Het
Ctrb1	A	G	8: 111,686,664	S239P	probably damaging	Het
D13Ertd608e	A	G	13: 119,846,130	D20G	possibly damaging	Het
Dennd1b	T	A	1: 139,168,945		probably benign	Het
Dnah17	A	G	11: 118,066,432	I2773T	probably damaging	Het
Eif2b2	T	A	12: 85,226,043	F267L	probably damaging	Het
Fcrls	A	G	3: 87,263,676		probably benign	Het
Furin	G	T	7: 80,396,964	D181E	possibly damaging	Het
Gm29106	T	A	1: 118,200,587	C670S	probably damaging	Het
Gm6309	A	T	5: 146,168,490	D204E	possibly damaging	Het
Hsf2	T	A	10: 57,504,643	I191N	probably damaging	Het
Hspa12a	T	C	19: 58,799,692	D566G	probably benign	Het
Igf1	G	C	10: 87,864,860	V49L	probably damaging	Het
Igfbpl1	C	T	4: 45,826,663	C44Y	probably damaging	Het
Letm1	G	A	5: 33,782,507	R16C	probably benign	Het
Marf1	A	G	16: 14,138,520	V819A	probably damaging	Het
Mfsd4b4	A	T	10: 39,891,952	S428T	probably benign	Het
Myo1d	T	C	11: 80,674,957	I347M	probably benign	Het
Myo9b	A	G	8: 71,290,819	I175V	probably damaging	Het
Naip5	A	T	13: 100,223,414	V438E	probably damaging	Het
Nup205	T	A	6: 35,208,109	V768E	possibly damaging	Het
Olfr1015	T	A	2: 85,786,382	Y290*	probably null	Het
Olfr731	A	T	14: 50,238,110	Y258*	probably null	Het
Pcdh15	C	T	10: 74,645,989	H1651Y	possibly damaging	Het
Pdgfra	A	T	5: 75,173,394	Q376L	possibly damaging	Het
Pign	T	C	1: 105,553,897	I791M	probably benign	Het
Pik3c2b	T	G	1: 133,066,303	S2A	possibly damaging	Het
Pip5k1a	A	T	3: 95,068,247	I304K	probably damaging	Het
Pkdrej	A	T	15: 85,817,853	L1294*	probably null	Het
Pprc1	T	C	19: 46,064,433	S797P	probably damaging	Het
Prob1	A	G	18: 35,654,268	V311A	probably benign	Het
Prune2	C	A	19: 17,000,021	T40K	probably damaging	Het
Rif1	T	G	2: 52,112,691	D2052E	probably benign	Het
Sall1	A	G	8: 89,032,891	V195A	probably damaging	Het
Scfd1	T	C	12: 51,427,946		probably null	Het
Sidt2	A	T	9: 45,952,850	N123K	probably benign	Het
Slc22a6	G	A	19: 8,622,096	A320T	probably benign	Het
Slc25a10	A	G	11: 120,498,147	H279R	probably benign	Het
Slc35b4	A	G	6: 34,158,621	V252A	probably benign	Het
Slc46a3	T	C	5: 147,886,340	T231A	probably benign	Het
Stxbp1	T	A	2: 32,801,893	H429L	probably damaging	Het
Tas2r134	C	T	2: 51,627,770	T87I	probably benign	Het
Tdpoz2	A	T	3: 93,652,275	L130H	probably damaging	Het
Tmem69	T	C	4: 116,554,724		probably null	Het
Tmppe	G	A	9: 114,405,523	V297I	probably benign	Het
Ung	G	T	5: 114,131,337	A37S	probably benign	Het
Vdac1	T	C	11: 52,386,373	Y237H	probably damaging	Het
Vgll4	T	C	6: 114,921,367	Y11C	probably damaging	Het
Vmn1r24	A	G	6: 57,956,452	I27T	probably benign	Het
Zfp280b	T	A	10: 76,039,688	M467K	probably benign	Het
Zkscan4	A	G	13: 21,484,365	I329V	probably damaging	Het

Other mutations in Cpsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Cpsf1	APN	15	76600216	missense	probably benign	0.27
IGL01013:Cpsf1	APN	15	76599297	nonsense	probably null
IGL01599:Cpsf1	APN	15	76596541	missense	probably damaging	1.00
IGL02008:Cpsf1	APN	15	76603091	missense	probably damaging	1.00
IGL02291:Cpsf1	APN	15	76602821	missense	probably damaging	1.00
IGL02901:Cpsf1	APN	15	76599496	nonsense	probably null
IGL02929:Cpsf1	APN	15	76602127	critical splice donor site	probably null
IGL03402:Cpsf1	APN	15	76596003	splice site	probably null
R0005:Cpsf1	UTSW	15	76600680	critical splice donor site	probably null
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0044:Cpsf1	UTSW	15	76599553	missense	probably benign
R0487:Cpsf1	UTSW	15	76597002	missense	probably damaging	1.00
R0510:Cpsf1	UTSW	15	76603657	intron	probably benign
R0630:Cpsf1	UTSW	15	76601971	missense	probably damaging	1.00
R0780:Cpsf1	UTSW	15	76600377	missense	probably benign	0.17
R1617:Cpsf1	UTSW	15	76602370	nonsense	probably null
R1717:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R1889:Cpsf1	UTSW	15	76602156	missense	probably benign	0.06
R1994:Cpsf1	UTSW	15	76603160	missense	probably benign	0.03
R2168:Cpsf1	UTSW	15	76603737	missense	possibly damaging	0.69
R2359:Cpsf1	UTSW	15	76597673	missense	probably benign	0.02
R2697:Cpsf1	UTSW	15	76599329	missense	probably damaging	1.00
R2847:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R2848:Cpsf1	UTSW	15	76602851	missense	probably damaging	1.00
R3409:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3410:Cpsf1	UTSW	15	76601781	nonsense	probably null
R3815:Cpsf1	UTSW	15	76601149	missense	probably benign	0.22
R4030:Cpsf1	UTSW	15	76601779	missense	possibly damaging	0.96
R4491:Cpsf1	UTSW	15	76597722	missense	possibly damaging	0.85
R4615:Cpsf1	UTSW	15	76596937	missense	possibly damaging	0.88
R5227:Cpsf1	UTSW	15	76598948	missense	probably damaging	1.00
R5353:Cpsf1	UTSW	15	76602571	missense	probably damaging	1.00
R5548:Cpsf1	UTSW	15	76597327	missense	possibly damaging	0.95
R5552:Cpsf1	UTSW	15	76599646	missense	probably benign	0.27
R5746:Cpsf1	UTSW	15	76599837	missense	probably benign	0.01
R6319:Cpsf1	UTSW	15	76596967	missense	probably damaging	1.00
R6360:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6572:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6574:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6576:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6577:Cpsf1	UTSW	15	76597455	frame shift	probably null
R6588:Cpsf1	UTSW	15	76596822	missense	probably damaging	1.00
R6595:Cpsf1	UTSW	15	76602510	missense	probably damaging	1.00
R6621:Cpsf1	UTSW	15	76603519	missense	probably damaging	1.00
R6880:Cpsf1	UTSW	15	76602539	missense	probably benign	0.06
R7100:Cpsf1	UTSW	15	76596114	missense	possibly damaging	0.73
R7255:Cpsf1	UTSW	15	76597543	missense	probably damaging	1.00
R7318:Cpsf1	UTSW	15	76597275	nonsense	probably null
R7371:Cpsf1	UTSW	15	76600575	missense	probably damaging	1.00
R7387:Cpsf1	UTSW	15	76602566	missense	possibly damaging	0.77
R7446:Cpsf1	UTSW	15	76601750	missense	probably benign
R7612:Cpsf1	UTSW	15	76597009	missense	probably benign	0.00
R7739:Cpsf1	UTSW	15	76600311	missense	probably benign	0.00
R7878:Cpsf1	UTSW	15	76600500	missense	probably damaging	1.00
R8334:Cpsf1	UTSW	15	76603587	missense	probably benign	0.26
R8345:Cpsf1	UTSW	15	76601490	missense	probably benign
R8382:Cpsf1	UTSW	15	76600951	missense	probably benign
R8403:Cpsf1	UTSW	15	76600283	missense	probably damaging	0.96
X0052:Cpsf1	UTSW	15	76596302	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTTAAGATTTCCCTGGCCAAGCTG -3'
(R):5'- TGACCATTGCCTCTCTGCAG -3'

Sequencing Primer
(F):5'- CTGGCCAAGCTGAGAGTCATG -3'
(R):5'- GATCTACCAGCTCCCAGACTGG -3'

Posted On

2018-11-28