Incidental Mutation 'R6954:Prob1'
ID 541395
Institutional Source Beutler Lab
Gene Symbol Prob1
Ensembl Gene ENSMUSG00000073600
Gene Name proline rich basic protein 1
Synonyms LOC381148, Gm1614
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock # R6954 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 35650351-35655238 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35654268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 311 (V311A)
Ref Sequence ENSEMBL: ENSMUSP00000140465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025209] [ENSMUST00000025211] [ENSMUST00000097619] [ENSMUST00000190196]
AlphaFold A0A087WR45
Predicted Effect probably benign
Transcript: ENSMUST00000025209
SMART Domains Protein: ENSMUSP00000025209
Gene: ENSMUSG00000024352

DomainStartEndE-ValueType
Pfam:SPATA24 10 191 1.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025211
SMART Domains Protein: ENSMUSP00000025211
Gene: ENSMUSG00000024353

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 48 177 5.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097619
AA Change: V307A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095224
Gene: ENSMUSG00000073600
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 78 102 N/A INTRINSIC
low complexity region 142 155 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 536 553 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
Pfam:DUF4585 862 931 4.6e-27 PFAM
low complexity region 989 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190196
AA Change: V311A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140465
Gene: ENSMUSG00000073600
AA Change: V311A

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
low complexity region 381 400 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 833 852 N/A INTRINSIC
Pfam:DUF4585 864 936 7.5e-27 PFAM
low complexity region 993 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Prob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Prob1 APN 18 35653333 missense possibly damaging 0.91
IGL02352:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02359:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02823:Prob1 APN 18 35652747 missense possibly damaging 0.86
IGL03003:Prob1 APN 18 35653375 missense possibly damaging 0.73
IGL03390:Prob1 APN 18 35654139 missense probably benign 0.03
R0257:Prob1 UTSW 18 35653039 missense possibly damaging 0.53
R0421:Prob1 UTSW 18 35653030 missense possibly damaging 0.70
R0457:Prob1 UTSW 18 35652486 missense probably damaging 0.98
R0485:Prob1 UTSW 18 35653825 missense possibly damaging 0.53
R0575:Prob1 UTSW 18 35654721 missense possibly damaging 0.85
R1056:Prob1 UTSW 18 35653610 missense probably benign
R1147:Prob1 UTSW 18 35654806 nonsense probably null
R1334:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1727:Prob1 UTSW 18 35654311 missense possibly damaging 0.73
R1753:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1826:Prob1 UTSW 18 35653575 missense possibly damaging 0.72
R1895:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R1937:Prob1 UTSW 18 35654226 missense possibly damaging 0.53
R2170:Prob1 UTSW 18 35654737 missense probably benign 0.18
R3435:Prob1 UTSW 18 35654241 missense possibly damaging 0.72
R4749:Prob1 UTSW 18 35652816 missense possibly damaging 0.91
R4968:Prob1 UTSW 18 35652552 missense probably damaging 0.98
R5107:Prob1 UTSW 18 35652936 missense possibly damaging 0.53
R5602:Prob1 UTSW 18 35654026 missense possibly damaging 0.96
R5646:Prob1 UTSW 18 35654114 missense probably benign 0.18
R6035:Prob1 UTSW 18 35654782 missense probably benign 0.18
R6747:Prob1 UTSW 18 35655154 missense probably damaging 0.97
R7061:Prob1 UTSW 18 35654500 missense probably benign 0.18
R7292:Prob1 UTSW 18 35654550 missense possibly damaging 0.93
R7296:Prob1 UTSW 18 35653299 missense possibly damaging 0.53
R7566:Prob1 UTSW 18 35654985 missense probably benign 0.33
R7723:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R7787:Prob1 UTSW 18 35652232 missense possibly damaging 0.73
R7798:Prob1 UTSW 18 35653344 missense possibly damaging 0.93
R8048:Prob1 UTSW 18 35653551 missense probably benign 0.00
R8101:Prob1 UTSW 18 35653233 missense possibly damaging 0.85
R8260:Prob1 UTSW 18 35654157 missense possibly damaging 0.86
R8676:Prob1 UTSW 18 35653986 missense possibly damaging 0.53
R9304:Prob1 UTSW 18 35654655 missense probably damaging 1.00
R9440:Prob1 UTSW 18 35653165 missense possibly damaging 0.53
X0067:Prob1 UTSW 18 35653091 missense possibly damaging 0.70
Z1088:Prob1 UTSW 18 35652769 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATCAGGAGTCTCACGGGGAAAC -3'
(R):5'- GAAACGTCAGATCGAGCTGC -3'

Sequencing Primer
(F):5'- TCTCACGGGGAAACTGGGTC -3'
(R):5'- TCCCTGGACGAGTCTCTGAG -3'
Posted On 2018-11-28