Incidental Mutation 'R6954:Pprc1'
ID541398
Institutional Source Beutler Lab
Gene Symbol Pprc1
Ensembl Gene ENSMUSG00000055491
Gene Nameperoxisome proliferative activated receptor, gamma, coactivator-related 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6954 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46044886-46072915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46064433 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 797 (S797P)
Ref Sequence ENSEMBL: ENSMUSP00000096990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062322] [ENSMUST00000099392] [ENSMUST00000111899] [ENSMUST00000126127] [ENSMUST00000135327] [ENSMUST00000147640] [ENSMUST00000150158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062322
AA Change: S801P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079389
Gene: ENSMUSG00000055491
AA Change: S801P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 214 240 N/A INTRINSIC
low complexity region 448 459 N/A INTRINSIC
low complexity region 516 525 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 732 739 N/A INTRINSIC
low complexity region 826 887 N/A INTRINSIC
low complexity region 915 925 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1020 1033 N/A INTRINSIC
low complexity region 1224 1240 N/A INTRINSIC
low complexity region 1397 1446 N/A INTRINSIC
low complexity region 1453 1504 N/A INTRINSIC
RRM 1526 1597 3.36e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099392
AA Change: S797P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096990
Gene: ENSMUSG00000055491
AA Change: S797P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 210 236 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
low complexity region 512 521 N/A INTRINSIC
low complexity region 642 657 N/A INTRINSIC
low complexity region 728 735 N/A INTRINSIC
low complexity region 822 883 N/A INTRINSIC
low complexity region 911 921 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 975 987 N/A INTRINSIC
low complexity region 1016 1029 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111899
AA Change: S800P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107530
Gene: ENSMUSG00000055491
AA Change: S800P

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 213 239 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 731 738 N/A INTRINSIC
low complexity region 825 886 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 938 959 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
low complexity region 1019 1032 N/A INTRINSIC
low complexity region 1222 1238 N/A INTRINSIC
low complexity region 1395 1444 N/A INTRINSIC
low complexity region 1451 1502 N/A INTRINSIC
RRM 1524 1595 3.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126127
Predicted Effect probably benign
Transcript: ENSMUST00000135327
Predicted Effect probably benign
Transcript: ENSMUST00000147640
Predicted Effect probably benign
Transcript: ENSMUST00000150158
SMART Domains Protein: ENSMUSP00000120475
Gene: ENSMUSG00000055491

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
low complexity region 102 128 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to PPAR-gamma coactivator 1 (PPARGC1/PGC-1), a protein that can activate mitochondrial biogenesis in part through a direct interaction with nuclear respiratory factor 1 (NRF1). This protein has been shown to interact with NRF1. It is thought to be a functional relative of PPAR-gamma coactivator 1 that activates mitochondrial biogenesis through NRF1 in response to proliferative signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit letahlity post-implantation with delayed hatching and disorganized embryo tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Hspa12a T C 19: 58,799,692 D566G probably benign Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Pprc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pprc1 APN 19 46062648 missense possibly damaging 0.93
IGL00825:Pprc1 APN 19 46071406 unclassified probably benign
IGL01445:Pprc1 APN 19 46065232 unclassified probably benign
IGL01449:Pprc1 APN 19 46065232 unclassified probably benign
IGL01475:Pprc1 APN 19 46071529 missense probably benign 0.03
IGL01750:Pprc1 APN 19 46071829 unclassified probably benign
IGL01779:Pprc1 APN 19 46062202 missense probably damaging 1.00
IGL01943:Pprc1 APN 19 46064544 unclassified probably benign
IGL02031:Pprc1 APN 19 46072343 unclassified probably benign
IGL02145:Pprc1 APN 19 46064890 unclassified probably benign
IGL02206:Pprc1 APN 19 46071751 missense probably damaging 0.98
IGL02439:Pprc1 APN 19 46072319 missense possibly damaging 0.94
IGL02675:Pprc1 APN 19 46063507 missense probably damaging 1.00
IGL03185:Pprc1 APN 19 46069747 intron probably benign
IGL03325:Pprc1 APN 19 46061509 missense possibly damaging 0.86
R0125:Pprc1 UTSW 19 46069512 intron probably benign
R0388:Pprc1 UTSW 19 46062775 missense possibly damaging 0.85
R0498:Pprc1 UTSW 19 46071568 nonsense probably null
R1129:Pprc1 UTSW 19 46063806 missense probably benign 0.35
R1439:Pprc1 UTSW 19 46063736 missense possibly damaging 0.94
R1536:Pprc1 UTSW 19 46071526 unclassified probably benign
R4551:Pprc1 UTSW 19 46067225 unclassified probably benign
R4698:Pprc1 UTSW 19 46069195 intron probably benign
R4822:Pprc1 UTSW 19 46071356 unclassified probably benign
R4909:Pprc1 UTSW 19 46064319 missense probably damaging 0.99
R4931:Pprc1 UTSW 19 46071316 unclassified probably benign
R5132:Pprc1 UTSW 19 46072682 unclassified probably benign
R5157:Pprc1 UTSW 19 46064758 unclassified probably benign
R5834:Pprc1 UTSW 19 46065220 unclassified probably benign
R5938:Pprc1 UTSW 19 46071316 unclassified probably benign
R5947:Pprc1 UTSW 19 46063672 missense possibly damaging 0.85
R5975:Pprc1 UTSW 19 46065370 unclassified probably benign
R6009:Pprc1 UTSW 19 46071732 missense probably damaging 1.00
R6259:Pprc1 UTSW 19 46064410 missense probably damaging 0.97
R7287:Pprc1 UTSW 19 46071354 missense unknown
R7355:Pprc1 UTSW 19 46065346 missense unknown
R7527:Pprc1 UTSW 19 46069365 missense unknown
R7632:Pprc1 UTSW 19 46072282 missense probably damaging 1.00
R7745:Pprc1 UTSW 19 46065342 missense unknown
R7896:Pprc1 UTSW 19 46061449 missense unknown
R7979:Pprc1 UTSW 19 46061449 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACAGGAATTCTCAGCCCC -3'
(R):5'- TAACAAGACCAGGGTGGCAC -3'

Sequencing Primer
(F):5'- AGGAATTCTCAGCCCCCAGTTG -3'
(R):5'- TGTCTCATTGATACTGGAAGTCC -3'
Posted On2018-11-28