Incidental Mutation 'R6954:Hspa12a'
ID541399
Institutional Source Beutler Lab
Gene Symbol Hspa12a
Ensembl Gene ENSMUSG00000025092
Gene Nameheat shock protein 12A
Synonyms1700063D12Rik, Hspa12a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R6954 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location58795751-58860984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58799692 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 566 (D566G)
Ref Sequence ENSEMBL: ENSMUSP00000066860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066285]
Predicted Effect probably benign
Transcript: ENSMUST00000066285
AA Change: D566G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000066860
Gene: ENSMUSG00000025092
AA Change: D566G

DomainStartEndE-ValueType
SCOP:d1bupa1 58 244 4e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T A 11: 58,608,488 Y168F probably benign Het
4930451I11Rik A T 7: 126,830,637 probably null Het
Alox5 A C 6: 116,420,280 Y314* probably null Het
Ap4e1 T C 2: 127,064,951 S1044P probably benign Het
Ash2l A G 8: 25,822,768 V391A possibly damaging Het
B4galnt4 A G 7: 141,067,232 T326A probably benign Het
Ccm2 T A 11: 6,594,239 I345N probably damaging Het
Cntnap3 G A 13: 64,748,559 H1034Y probably benign Het
Cpsf1 A G 15: 76,599,496 L849S probably damaging Het
Ctrb1 A G 8: 111,686,664 S239P probably damaging Het
D13Ertd608e A G 13: 119,846,130 D20G possibly damaging Het
Dennd1b T A 1: 139,168,945 probably benign Het
Dnah17 A G 11: 118,066,432 I2773T probably damaging Het
Eif2b2 T A 12: 85,226,043 F267L probably damaging Het
Fcrls A G 3: 87,263,676 probably benign Het
Furin G T 7: 80,396,964 D181E possibly damaging Het
Gm29106 T A 1: 118,200,587 C670S probably damaging Het
Gm6309 A T 5: 146,168,490 D204E possibly damaging Het
Hsf2 T A 10: 57,504,643 I191N probably damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Igfbpl1 C T 4: 45,826,663 C44Y probably damaging Het
Letm1 G A 5: 33,782,507 R16C probably benign Het
Marf1 A G 16: 14,138,520 V819A probably damaging Het
Mfsd4b4 A T 10: 39,891,952 S428T probably benign Het
Myo1d T C 11: 80,674,957 I347M probably benign Het
Myo9b A G 8: 71,290,819 I175V probably damaging Het
Naip5 A T 13: 100,223,414 V438E probably damaging Het
Nup205 T A 6: 35,208,109 V768E possibly damaging Het
Olfr1015 T A 2: 85,786,382 Y290* probably null Het
Olfr731 A T 14: 50,238,110 Y258* probably null Het
Pcdh15 C T 10: 74,645,989 H1651Y possibly damaging Het
Pdgfra A T 5: 75,173,394 Q376L possibly damaging Het
Pign T C 1: 105,553,897 I791M probably benign Het
Pik3c2b T G 1: 133,066,303 S2A possibly damaging Het
Pip5k1a A T 3: 95,068,247 I304K probably damaging Het
Pkdrej A T 15: 85,817,853 L1294* probably null Het
Pprc1 T C 19: 46,064,433 S797P probably damaging Het
Prob1 A G 18: 35,654,268 V311A probably benign Het
Prune2 C A 19: 17,000,021 T40K probably damaging Het
Rif1 T G 2: 52,112,691 D2052E probably benign Het
Sall1 A G 8: 89,032,891 V195A probably damaging Het
Scfd1 T C 12: 51,427,946 probably null Het
Sidt2 A T 9: 45,952,850 N123K probably benign Het
Slc22a6 G A 19: 8,622,096 A320T probably benign Het
Slc25a10 A G 11: 120,498,147 H279R probably benign Het
Slc35b4 A G 6: 34,158,621 V252A probably benign Het
Slc46a3 T C 5: 147,886,340 T231A probably benign Het
Stxbp1 T A 2: 32,801,893 H429L probably damaging Het
Tas2r134 C T 2: 51,627,770 T87I probably benign Het
Tdpoz2 A T 3: 93,652,275 L130H probably damaging Het
Tmem69 T C 4: 116,554,724 probably null Het
Tmppe G A 9: 114,405,523 V297I probably benign Het
Ung G T 5: 114,131,337 A37S probably benign Het
Vdac1 T C 11: 52,386,373 Y237H probably damaging Het
Vgll4 T C 6: 114,921,367 Y11C probably damaging Het
Vmn1r24 A G 6: 57,956,452 I27T probably benign Het
Zfp280b T A 10: 76,039,688 M467K probably benign Het
Zkscan4 A G 13: 21,484,365 I329V probably damaging Het
Other mutations in Hspa12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Hspa12a APN 19 58828249 splice site probably null
IGL01516:Hspa12a APN 19 58827676 missense probably benign 0.00
IGL01766:Hspa12a APN 19 58799467 missense probably damaging 0.99
IGL01986:Hspa12a APN 19 58799402 missense probably benign 0.30
IGL02138:Hspa12a APN 19 58828298 missense probably benign 0.45
IGL02170:Hspa12a APN 19 58804681 missense probably benign 0.01
IGL02576:Hspa12a APN 19 58799410 missense possibly damaging 0.56
IGL02623:Hspa12a APN 19 58809551 missense probably benign 0.01
IGL02890:Hspa12a APN 19 58820999 critical splice donor site probably null
IGL03209:Hspa12a APN 19 58822061 splice site probably null
IGL03343:Hspa12a APN 19 58799396 missense probably benign 0.00
R0040:Hspa12a UTSW 19 58799624 missense probably benign 0.10
R0090:Hspa12a UTSW 19 58799509 missense probably benign 0.00
R2139:Hspa12a UTSW 19 58799482 missense probably benign
R4031:Hspa12a UTSW 19 58800857 missense probably benign 0.17
R4686:Hspa12a UTSW 19 58799749 missense possibly damaging 0.90
R4914:Hspa12a UTSW 19 58799452 missense probably damaging 1.00
R5046:Hspa12a UTSW 19 58799545 missense probably damaging 1.00
R5580:Hspa12a UTSW 19 58799660 missense probably benign 0.11
R5615:Hspa12a UTSW 19 58804650 missense possibly damaging 0.56
R5781:Hspa12a UTSW 19 58822086 missense probably damaging 0.99
R6777:Hspa12a UTSW 19 58822087 missense probably benign 0.03
R7038:Hspa12a UTSW 19 58804700 missense probably damaging 1.00
R7151:Hspa12a UTSW 19 58822162 missense probably benign 0.07
R7249:Hspa12a UTSW 19 58805433 missense probably benign 0.27
R7677:Hspa12a UTSW 19 58860885 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGATGGTCTGGATCTCTCTGC -3'
(R):5'- GCGACAAATGCAGGATCATC -3'

Sequencing Primer
(F):5'- TCCCCGTGAGATCCAAGC -3'
(R):5'- CTGCCGTTATCAAGGTG -3'
Posted On2018-11-28