Incidental Mutation 'R6955:Klb'
ID541408
Institutional Source Beutler Lab
Gene Symbol Klb
Ensembl Gene ENSMUSG00000029195
Gene Nameklotho beta
SynonymsbetaKlotho
Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R6955 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65348314-65384007 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 65379088 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 587 (L587*)
Ref Sequence ENSEMBL: ENSMUSP00000031096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]
Predicted Effect probably null
Transcript: ENSMUST00000031096
AA Change: L587*
SMART Domains Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: L587*

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 385 8.8e-96 PFAM
Pfam:Glyco_hydro_1 374 506 1.7e-31 PFAM
Pfam:Glyco_hydro_1 515 965 6.3e-80 PFAM
transmembrane domain 995 1017 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205084
SMART Domains Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 77 360 8.6e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,294,307 F2057I probably benign Het
Abl2 A G 1: 156,622,649 T108A probably damaging Het
Amfr A T 8: 94,000,376 W70R probably damaging Het
Cacna1h T C 17: 25,388,056 T963A probably damaging Het
Cdca2 A G 14: 67,715,004 M1T probably null Het
Chd2 A G 7: 73,475,423 V62A probably damaging Het
Cpeb4 T A 11: 31,908,864 L87Q possibly damaging Het
Ddx17 T C 15: 79,530,467 M500V probably benign Het
Emilin1 T C 5: 30,917,909 L498P probably damaging Het
Fhod1 C T 8: 105,333,007 C682Y probably benign Het
Fshr A T 17: 88,985,466 S595T probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Inf2 T C 12: 112,610,731 V1003A unknown Het
Itpr3 A G 17: 27,121,467 E2651G probably damaging Het
Kalrn A G 16: 34,220,136 W735R probably damaging Het
Kdelc1 A T 1: 44,117,097 L110Q probably damaging Het
Kif5b T C 18: 6,211,070 N798S probably benign Het
Krt82 T A 15: 101,542,849 D375V probably damaging Het
Lig4 A T 8: 9,973,384 V132D probably damaging Het
Lrpprc T C 17: 84,776,989 I99V probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Mcam T A 9: 44,139,269 I286N probably damaging Het
Myh15 G T 16: 49,081,235 probably null Het
Nup210 T C 6: 91,087,927 E197G probably damaging Het
Nup93 T A 8: 94,309,673 Y702N probably damaging Het
Olfr1192-ps1 T A 2: 88,653,004 I284N probably damaging Het
Osbpl8 T C 10: 111,269,444 probably null Het
Pdzd2 A G 15: 12,401,464 S767P probably damaging Het
Plcd1 A T 9: 119,071,856 N765K probably benign Het
Rnf208 T C 2: 25,243,402 V36A probably benign Het
Rpl5 G A 5: 107,902,046 R33Q probably benign Het
Selp A T 1: 164,144,909 I706F possibly damaging Het
Sfmbt1 A G 14: 30,766,034 probably benign Het
Slc25a39 T C 11: 102,403,518 I328V probably benign Het
Smc4 G A 3: 69,024,309 E604K possibly damaging Het
Sorcs3 A G 19: 48,749,343 Y733C possibly damaging Het
Ttll5 T C 12: 85,864,579 V237A possibly damaging Het
Uimc1 T A 13: 55,040,546 R567W possibly damaging Het
Wbp4 A T 14: 79,472,360 I145N probably benign Het
Xbp1 A G 11: 5,522,018 E32G probably null Het
Other mutations in Klb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Klb APN 5 65372374 missense possibly damaging 0.90
IGL00821:Klb APN 5 65372149 missense probably damaging 1.00
IGL01082:Klb APN 5 65375940 missense possibly damaging 0.71
IGL01637:Klb APN 5 65375679 critical splice acceptor site probably null
IGL02098:Klb APN 5 65379885 missense probably benign 0.21
IGL03113:Klb APN 5 65383470 missense probably benign 0.00
1mM(1):Klb UTSW 5 65348650 missense probably damaging 1.00
P0016:Klb UTSW 5 65379923 nonsense probably null
R0268:Klb UTSW 5 65348837 missense probably benign 0.02
R0383:Klb UTSW 5 65372499 intron probably null
R0676:Klb UTSW 5 65379055 missense probably damaging 1.00
R0735:Klb UTSW 5 65379727 missense probably benign
R0972:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1051:Klb UTSW 5 65379327 missense probably damaging 1.00
R1168:Klb UTSW 5 65378974 missense probably damaging 1.00
R1372:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1403:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1446:Klb UTSW 5 65348995 missense probably damaging 1.00
R1696:Klb UTSW 5 65348746 missense possibly damaging 0.70
R1743:Klb UTSW 5 65375861 missense probably damaging 0.99
R1801:Klb UTSW 5 65349235 missense probably null 0.90
R1804:Klb UTSW 5 65379853 missense probably damaging 1.00
R1848:Klb UTSW 5 65348837 missense probably benign 0.02
R1967:Klb UTSW 5 65372074 missense probably damaging 0.98
R3420:Klb UTSW 5 65372142 missense probably damaging 1.00
R4397:Klb UTSW 5 65380039 missense probably damaging 1.00
R4490:Klb UTSW 5 65375794 missense probably benign 0.02
R4491:Klb UTSW 5 65375794 missense probably benign 0.02
R4547:Klb UTSW 5 65379928 missense probably benign 0.00
R4878:Klb UTSW 5 65348490 missense probably damaging 0.99
R5269:Klb UTSW 5 65348797 missense probably damaging 1.00
R5418:Klb UTSW 5 65383470 missense probably benign 0.00
R5453:Klb UTSW 5 65383385 missense probably benign 0.08
R5541:Klb UTSW 5 65379234 missense probably benign 0.27
R5672:Klb UTSW 5 65379949 missense possibly damaging 0.82
R5841:Klb UTSW 5 65379324 nonsense probably null
R6088:Klb UTSW 5 65349013 missense probably benign 0.07
R6807:Klb UTSW 5 65379534 missense probably damaging 1.00
R7068:Klb UTSW 5 65379340 missense probably damaging 1.00
R7284:Klb UTSW 5 65383478 missense probably benign 0.01
R7322:Klb UTSW 5 65383364 missense probably benign 0.44
R7346:Klb UTSW 5 65348631 nonsense probably null
R7366:Klb UTSW 5 65372431 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGATTTACCTGGGTGCC -3'
(R):5'- GCTGTGTTCATGTTTAGCCAC -3'

Sequencing Primer
(F):5'- GGTGCCTTTGTCTCCCACAG -3'
(R):5'- CACTGCTCAGAAGTGGCAG -3'
Posted On2018-11-28