Incidental Mutation 'R6955:Nup93'
ID 541415
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Name nucleoporin 93
Synonyms 2410008G02Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # R6955 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 94214564-94317227 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94309673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 702 (Y702N)
Ref Sequence ENSEMBL: ENSMUSP00000148700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]
AlphaFold Q8BJ71
Predicted Effect probably damaging
Transcript: ENSMUST00000079961
AA Change: Y702N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: Y702N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109547
AA Change: Y702N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: Y702N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211822
AA Change: Y579N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000212824
AA Change: Y702N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,294,307 F2057I probably benign Het
Abl2 A G 1: 156,622,649 T108A probably damaging Het
Amfr A T 8: 94,000,376 W70R probably damaging Het
Cacna1h T C 17: 25,388,056 T963A probably damaging Het
Cdca2 A G 14: 67,715,004 M1T probably null Het
Chd2 A G 7: 73,475,423 V62A probably damaging Het
Cpeb4 T A 11: 31,908,864 L87Q possibly damaging Het
Ddx17 T C 15: 79,530,467 M500V probably benign Het
Emilin1 T C 5: 30,917,909 L498P probably damaging Het
Fhod1 C T 8: 105,333,007 C682Y probably benign Het
Fshr A T 17: 88,985,466 S595T probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Inf2 T C 12: 112,610,731 V1003A unknown Het
Itpr3 A G 17: 27,121,467 E2651G probably damaging Het
Kalrn A G 16: 34,220,136 W735R probably damaging Het
Kdelc1 A T 1: 44,117,097 L110Q probably damaging Het
Kif5b T C 18: 6,211,070 N798S probably benign Het
Klb T A 5: 65,379,088 L587* probably null Het
Krt82 T A 15: 101,542,849 D375V probably damaging Het
Lig4 A T 8: 9,973,384 V132D probably damaging Het
Lrpprc T C 17: 84,776,989 I99V probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Mcam T A 9: 44,139,269 I286N probably damaging Het
Myh15 G T 16: 49,081,235 probably null Het
Nup210 T C 6: 91,087,927 E197G probably damaging Het
Olfr1192-ps1 T A 2: 88,653,004 I284N probably damaging Het
Osbpl8 T C 10: 111,269,444 probably null Het
Pdzd2 A G 15: 12,401,464 S767P probably damaging Het
Plcd1 A T 9: 119,071,856 N765K probably benign Het
Rnf208 T C 2: 25,243,402 V36A probably benign Het
Rpl5 G A 5: 107,902,046 R33Q probably benign Het
Selp A T 1: 164,144,909 I706F possibly damaging Het
Sfmbt1 A G 14: 30,766,034 probably benign Het
Slc25a39 T C 11: 102,403,518 I328V probably benign Het
Smc4 G A 3: 69,024,309 E604K possibly damaging Het
Sorcs3 A G 19: 48,749,343 Y733C possibly damaging Het
Ttll5 T C 12: 85,864,579 V237A possibly damaging Het
Uimc1 T A 13: 55,040,546 R567W possibly damaging Het
Wbp4 A T 14: 79,472,360 I145N probably benign Het
Xbp1 A G 11: 5,522,018 E32G probably null Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 94309023 critical splice donor site probably null
IGL01652:Nup93 APN 8 94296559 missense possibly damaging 0.93
IGL02003:Nup93 APN 8 94302109 nonsense probably null
IGL02169:Nup93 APN 8 94302129 missense probably damaging 1.00
IGL02212:Nup93 APN 8 94311662 critical splice donor site probably null
IGL02551:Nup93 APN 8 94227833 nonsense probably null
IGL02568:Nup93 APN 8 94309635 missense probably damaging 1.00
IGL03094:Nup93 APN 8 94296502 missense probably benign
IGL03248:Nup93 APN 8 94306088 missense probably damaging 0.98
IGL03273:Nup93 APN 8 94306277 missense probably benign 0.01
IGL03401:Nup93 APN 8 94309711 splice site probably null
PIT4585001:Nup93 UTSW 8 94243727 missense probably benign 0.25
R0409:Nup93 UTSW 8 94303665 missense probably damaging 1.00
R0748:Nup93 UTSW 8 94307943 missense probably damaging 1.00
R0891:Nup93 UTSW 8 94281263 splice site probably benign
R1667:Nup93 UTSW 8 94292687 missense possibly damaging 0.71
R1696:Nup93 UTSW 8 94296555 missense probably benign 0.29
R1862:Nup93 UTSW 8 94306102 missense probably damaging 1.00
R2069:Nup93 UTSW 8 94243739 missense probably damaging 1.00
R2143:Nup93 UTSW 8 94296480 nonsense probably null
R2187:Nup93 UTSW 8 94300850 missense probably damaging 1.00
R2228:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2229:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2254:Nup93 UTSW 8 94227857 critical splice donor site probably null
R2884:Nup93 UTSW 8 94303638 missense probably damaging 1.00
R4521:Nup93 UTSW 8 94314636 missense probably damaging 1.00
R4563:Nup93 UTSW 8 94307892 missense probably damaging 1.00
R4900:Nup93 UTSW 8 94286603 missense probably benign 0.25
R5570:Nup93 UTSW 8 94314670 missense probably damaging 1.00
R6226:Nup93 UTSW 8 94286537 missense probably damaging 1.00
R6489:Nup93 UTSW 8 94302088 missense probably benign 0.10
R6658:Nup93 UTSW 8 94304179 missense probably benign 0.02
R6817:Nup93 UTSW 8 94314682 critical splice donor site probably null
R6895:Nup93 UTSW 8 94243686 missense probably damaging 1.00
R7476:Nup93 UTSW 8 94303632 missense probably damaging 1.00
R7643:Nup93 UTSW 8 94286619 critical splice donor site probably null
R7994:Nup93 UTSW 8 94306302 missense probably benign 0.15
R8461:Nup93 UTSW 8 94281335 critical splice donor site probably null
R9177:Nup93 UTSW 8 94227743 missense probably benign 0.25
R9264:Nup93 UTSW 8 94292720 missense probably benign 0.01
R9532:Nup93 UTSW 8 94314621 missense probably damaging 1.00
R9567:Nup93 UTSW 8 94308976 missense possibly damaging 0.94
R9629:Nup93 UTSW 8 94306639 missense probably damaging 0.99
R9721:Nup93 UTSW 8 94303685 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCGTCACAATGAACACTG -3'
(R):5'- CAGAGCTTTCTTTCAGAAGTCTG -3'

Sequencing Primer
(F):5'- TGTTGTGCCCGTCCAGAGAG -3'
(R):5'- CTCAGGATCACACTTGTCTC -3'
Posted On 2018-11-28