Incidental Mutation 'R6955:Fshr'
ID541438
Institutional Source Beutler Lab
Gene Symbol Fshr
Ensembl Gene ENSMUSG00000032937
Gene Namefollicle stimulating hormone receptor
SynonymsFSH-R, Follitropin receptor, follicle-stimulating hormone receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6955 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location88985170-89200612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88985466 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 595 (S595T)
Ref Sequence ENSEMBL: ENSMUSP00000040477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035701]
Predicted Effect probably benign
Transcript: ENSMUST00000035701
AA Change: S595T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000040477
Gene: ENSMUSG00000032937
AA Change: S595T

DomainStartEndE-ValueType
LRRNT 17 50 3.93e-3 SMART
Pfam:LRR_5 134 249 9e-7 PFAM
Pfam:GnHR_trans 282 348 4.6e-27 PFAM
Pfam:7tm_1 378 625 1.9e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mutant females are sterile with small ovaries, blocked follicular development, atrophic uterus and imperforate vagina. Mutant males are fertile despite reduction in testis weight, oligozoospermia and reduced testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,294,307 F2057I probably benign Het
Abl2 A G 1: 156,622,649 T108A probably damaging Het
Amfr A T 8: 94,000,376 W70R probably damaging Het
Cacna1h T C 17: 25,388,056 T963A probably damaging Het
Cdca2 A G 14: 67,715,004 M1T probably null Het
Chd2 A G 7: 73,475,423 V62A probably damaging Het
Cpeb4 T A 11: 31,908,864 L87Q possibly damaging Het
Ddx17 T C 15: 79,530,467 M500V probably benign Het
Emilin1 T C 5: 30,917,909 L498P probably damaging Het
Fhod1 C T 8: 105,333,007 C682Y probably benign Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Inf2 T C 12: 112,610,731 V1003A unknown Het
Itpr3 A G 17: 27,121,467 E2651G probably damaging Het
Kalrn A G 16: 34,220,136 W735R probably damaging Het
Kdelc1 A T 1: 44,117,097 L110Q probably damaging Het
Kif5b T C 18: 6,211,070 N798S probably benign Het
Klb T A 5: 65,379,088 L587* probably null Het
Krt82 T A 15: 101,542,849 D375V probably damaging Het
Lig4 A T 8: 9,973,384 V132D probably damaging Het
Lrpprc T C 17: 84,776,989 I99V probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Mcam T A 9: 44,139,269 I286N probably damaging Het
Myh15 G T 16: 49,081,235 probably null Het
Nup210 T C 6: 91,087,927 E197G probably damaging Het
Nup93 T A 8: 94,309,673 Y702N probably damaging Het
Olfr1192-ps1 T A 2: 88,653,004 I284N probably damaging Het
Osbpl8 T C 10: 111,269,444 probably null Het
Pdzd2 A G 15: 12,401,464 S767P probably damaging Het
Plcd1 A T 9: 119,071,856 N765K probably benign Het
Rnf208 T C 2: 25,243,402 V36A probably benign Het
Rpl5 G A 5: 107,902,046 R33Q probably benign Het
Selp A T 1: 164,144,909 I706F possibly damaging Het
Sfmbt1 A G 14: 30,766,034 probably benign Het
Slc25a39 T C 11: 102,403,518 I328V probably benign Het
Smc4 G A 3: 69,024,309 E604K possibly damaging Het
Sorcs3 A G 19: 48,749,343 Y733C possibly damaging Het
Ttll5 T C 12: 85,864,579 V237A possibly damaging Het
Uimc1 T A 13: 55,040,546 R567W possibly damaging Het
Wbp4 A T 14: 79,472,360 I145N probably benign Het
Xbp1 A G 11: 5,522,018 E32G probably null Het
Other mutations in Fshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Fshr APN 17 88986191 missense probably damaging 1.00
IGL00272:Fshr APN 17 88985271 missense probably benign 0.00
IGL01067:Fshr APN 17 88985393 missense possibly damaging 0.95
IGL02093:Fshr APN 17 89001889 splice site probably null
IGL03184:Fshr APN 17 89046640 missense possibly damaging 0.80
IGL03383:Fshr APN 17 89046699 missense possibly damaging 0.69
IGL03383:Fshr APN 17 88985693 missense probably damaging 0.98
benedict UTSW 17 88985469 missense probably damaging 1.00
incremental UTSW 17 88985986 missense probably damaging 1.00
positively UTSW 17 88988607 missense probably damaging 1.00
R0056:Fshr UTSW 17 88988457 missense probably damaging 1.00
R0119:Fshr UTSW 17 89009285 missense probably benign 0.34
R0299:Fshr UTSW 17 89009285 missense probably benign 0.34
R0499:Fshr UTSW 17 89009285 missense probably benign 0.34
R0550:Fshr UTSW 17 89045125 missense probably benign 0.00
R1499:Fshr UTSW 17 88986101 missense probably damaging 1.00
R1656:Fshr UTSW 17 89200581 missense unknown
R2435:Fshr UTSW 17 89200596 missense unknown
R3730:Fshr UTSW 17 89001715 missense probably benign 0.00
R3928:Fshr UTSW 17 88985534 missense probably damaging 1.00
R4065:Fshr UTSW 17 88985966 missense probably damaging 1.00
R4625:Fshr UTSW 17 88985720 missense probably damaging 1.00
R5062:Fshr UTSW 17 88986046 nonsense probably null
R5103:Fshr UTSW 17 89097368 missense possibly damaging 0.88
R5212:Fshr UTSW 17 88986256 missense probably benign 0.00
R5212:Fshr UTSW 17 88986257 missense probably benign 0.04
R5311:Fshr UTSW 17 89011013 critical splice donor site probably null
R5456:Fshr UTSW 17 88986348 missense probably benign
R5478:Fshr UTSW 17 89001715 missense probably benign 0.00
R5577:Fshr UTSW 17 88985923 missense probably benign 0.00
R5651:Fshr UTSW 17 88985829 missense possibly damaging 0.62
R5715:Fshr UTSW 17 88986396 critical splice acceptor site probably null
R5750:Fshr UTSW 17 88986241 missense probably benign 0.01
R5797:Fshr UTSW 17 89011075 missense probably damaging 1.00
R6041:Fshr UTSW 17 88985986 missense probably damaging 1.00
R6306:Fshr UTSW 17 89200533 missense probably null 0.00
R6589:Fshr UTSW 17 88988607 missense probably damaging 1.00
R7080:Fshr UTSW 17 89097111 intron probably null
R7139:Fshr UTSW 17 88986161 missense possibly damaging 0.46
R7196:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7197:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7289:Fshr UTSW 17 88985844 missense probably benign 0.35
R7480:Fshr UTSW 17 88985374 nonsense probably null
R7562:Fshr UTSW 17 88988497 missense probably damaging 1.00
R7710:Fshr UTSW 17 88985255 missense probably benign 0.00
R7742:Fshr UTSW 17 88986162 missense probably benign
R7821:Fshr UTSW 17 88986213 missense probably damaging 0.99
R8043:Fshr UTSW 17 88986390 missense probably benign 0.06
Z1176:Fshr UTSW 17 89046667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGCTTGCACCTCATAACAG -3'
(R):5'- TGCCCATGGATATCGACAGC -3'

Sequencing Primer
(F):5'- GCCAAACTTGCTCATCAGGACG -3'
(R):5'- ATGGATATCGACAGCCCTTTG -3'
Posted On2018-11-28