Incidental Mutation 'R6956:Pfkfb2'
ID541442
Institutional Source Beutler Lab
Gene Symbol Pfkfb2
Ensembl Gene ENSMUSG00000026409
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2
Synonyms4930568D07Rik, PFK-2/FBPase-2 gene B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6956 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130689182-130729253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130707600 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 75 (N75D)
Ref Sequence ENSEMBL: ENSMUSP00000140698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
Predicted Effect probably damaging
Transcript: ENSMUST00000050406
AA Change: N75D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066863
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169659
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171479
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185233
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably damaging
Transcript: ENSMUST00000187089
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188520
AA Change: N75D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189167
AA Change: N75D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189534
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191301
AA Change: N75D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191347
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409
AA Change: N75D

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Pfkfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Pfkfb2 APN 1 130705370 splice site probably benign
IGL02273:Pfkfb2 APN 1 130707582 missense probably damaging 1.00
IGL02369:Pfkfb2 APN 1 130700835 missense probably damaging 0.99
IGL02469:Pfkfb2 APN 1 130700037 missense probably damaging 1.00
IGL02490:Pfkfb2 APN 1 130700852 missense probably damaging 1.00
R0080:Pfkfb2 UTSW 1 130714542 missense probably benign 0.20
R0616:Pfkfb2 UTSW 1 130706422 splice site probably null
R1458:Pfkfb2 UTSW 1 130708190 missense possibly damaging 0.89
R1490:Pfkfb2 UTSW 1 130697889 intron probably null
R1548:Pfkfb2 UTSW 1 130698083 missense probably benign
R1554:Pfkfb2 UTSW 1 130706472 missense probably damaging 1.00
R2143:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2144:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2145:Pfkfb2 UTSW 1 130698723 missense probably benign 0.00
R2212:Pfkfb2 UTSW 1 130707532 missense probably damaging 1.00
R2938:Pfkfb2 UTSW 1 130705410 missense possibly damaging 0.95
R4650:Pfkfb2 UTSW 1 130705463 missense possibly damaging 0.67
R4683:Pfkfb2 UTSW 1 130706484 critical splice acceptor site probably null
R5153:Pfkfb2 UTSW 1 130701790 missense probably damaging 1.00
R5914:Pfkfb2 UTSW 1 130700095 missense probably damaging 1.00
R5976:Pfkfb2 UTSW 1 130708079 nonsense probably null
R6194:Pfkfb2 UTSW 1 130697887 makesense probably null
R6285:Pfkfb2 UTSW 1 130707562 nonsense probably null
R6971:Pfkfb2 UTSW 1 130700796 missense probably damaging 1.00
R7723:Pfkfb2 UTSW 1 130707588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATCCAACCTAAGCTGGTC -3'
(R):5'- AAACCCTTGGTACCTGTGTC -3'

Sequencing Primer
(F):5'- CAACCTAAGCTGGTCTTTCAATCTAG -3'
(R):5'- CCTAAATGGTACTCTGGTAAAACAG -3'
Posted On2018-11-28