Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Pfkfb2'

541442

Institutional Source

Beutler Lab

Gene Symbol

Pfkfb2

Ensembl Gene

ENSMUSG00000026409

Gene Name

6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2

Synonyms

4930568D07Rik, PFK-2/FBPase-2 gene B

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130689182-130729253 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130707600 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 75 (N75D)

Ref Sequence

ENSEMBL: ENSMUSP00000140698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000050406
AA Change: N75D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	8.1e-107	PFAM
Pfam:KTI12	40	206	9.6e-8	PFAM
Pfam:AAA_33	42	198	3.1e-9	PFAM
PGAM	253	400	3.82e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000066863
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	1.2e-106	PFAM
Pfam:KTI12	41	207	3.5e-8	PFAM
Pfam:AAA_33	42	199	1.2e-10	PFAM
PGAM	253	400	3.82e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169659
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	1.3e-106	PFAM
Pfam:KTI12	41	207	4.3e-8	PFAM
Pfam:AAA_33	42	199	1.2e-10	PFAM
PGAM	253	400	3.82e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171479
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	1.2e-106	PFAM
Pfam:KTI12	41	208	3.7e-8	PFAM
Pfam:AAA_33	42	199	1.1e-10	PFAM
PGAM	253	400	3.82e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185233
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	1.2e-106	PFAM
Pfam:KTI12	41	207	3.5e-8	PFAM
Pfam:AAA_33	42	199	1.2e-10	PFAM
PGAM	253	400	3.82e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186777

Predicted Effect

probably benign
Transcript: ENSMUST00000186867

Predicted Effect

probably damaging
Transcript: ENSMUST00000187089
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	1e-103	PFAM
Pfam:KTI12	41	207	2.3e-5	PFAM
Pfam:AAA_33	42	199	1.4e-8	PFAM
PGAM	253	400	2.9e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000188520
AA Change: N75D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	6.3e-107	PFAM
Pfam:KTI12	41	209	2.3e-8	PFAM
Pfam:AAA_33	42	199	6.4e-11	PFAM
PGAM	253	342	1.31e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189167
AA Change: N75D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	6.3e-107	PFAM
Pfam:KTI12	41	209	2.3e-8	PFAM
Pfam:AAA_33	42	199	6.4e-11	PFAM
PGAM	253	342	1.31e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000189534
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	1.2e-106	PFAM
Pfam:KTI12	41	208	3.7e-8	PFAM
Pfam:AAA_33	42	199	1.1e-10	PFAM
PGAM	253	400	3.82e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191301
AA Change: N75D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	181	9.5e-70	PFAM
Pfam:KTI12	41	183	3.2e-8	PFAM
Pfam:AAA_33	42	184	1.1e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000191347
AA Change: N75D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409
AA Change: N75D

Domain	Start	End	E-Value	Type
Pfam:6PF2K	28	251	1.2e-103	PFAM
Pfam:KTI12	41	207	2.4e-5	PFAM
Pfam:AAA_33	42	199	1.6e-8	PFAM
PGAM	253	400	2.9e-20	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate, and a fructose-2,6-biphosphatase activity that catalyzes the degradation of fructose-2,6-bisphosphate. This protein regulates fructose-2,6-bisphosphate levels in the heart, while a related enzyme encoded by a different gene regulates fructose-2,6-bisphosphate levels in the liver and muscle. This enzyme functions as a homodimer. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Aars	G	A	8: 111,055,130	V945M	probably benign	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,297,558	D604G	probably damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Nat10	T	C	2: 103,734,412	I495V	probably benign	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 91,286,313		probably null	Het
Scube1	T	C	15: 83,721,876	Y65C	probably damaging	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp1	A	G	4: 98,931,006	E235G	probably damaging	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Pfkfb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01990:Pfkfb2	APN	1	130705370	splice site	probably benign
IGL02273:Pfkfb2	APN	1	130707582	missense	probably damaging	1.00
IGL02369:Pfkfb2	APN	1	130700835	missense	probably damaging	0.99
IGL02469:Pfkfb2	APN	1	130700037	missense	probably damaging	1.00
IGL02490:Pfkfb2	APN	1	130700852	missense	probably damaging	1.00
R0080:Pfkfb2	UTSW	1	130714542	missense	probably benign	0.20
R0616:Pfkfb2	UTSW	1	130706422	splice site	probably null
R1458:Pfkfb2	UTSW	1	130708190	missense	possibly damaging	0.89
R1490:Pfkfb2	UTSW	1	130697889	splice site	probably null
R1548:Pfkfb2	UTSW	1	130698083	missense	probably benign
R1554:Pfkfb2	UTSW	1	130706472	missense	probably damaging	1.00
R2143:Pfkfb2	UTSW	1	130698723	missense	probably benign	0.00
R2144:Pfkfb2	UTSW	1	130698723	missense	probably benign	0.00
R2145:Pfkfb2	UTSW	1	130698723	missense	probably benign	0.00
R2212:Pfkfb2	UTSW	1	130707532	missense	probably damaging	1.00
R2938:Pfkfb2	UTSW	1	130705410	missense	possibly damaging	0.95
R4650:Pfkfb2	UTSW	1	130705463	missense	possibly damaging	0.67
R4683:Pfkfb2	UTSW	1	130706484	critical splice acceptor site	probably null
R5153:Pfkfb2	UTSW	1	130701790	missense	probably damaging	1.00
R5914:Pfkfb2	UTSW	1	130700095	missense	probably damaging	1.00
R5976:Pfkfb2	UTSW	1	130708079	nonsense	probably null
R6194:Pfkfb2	UTSW	1	130697887	makesense	probably null
R6285:Pfkfb2	UTSW	1	130707562	nonsense	probably null
R6971:Pfkfb2	UTSW	1	130700796	missense	probably damaging	1.00
R7723:Pfkfb2	UTSW	1	130707588	missense	probably damaging	1.00
R8475:Pfkfb2	UTSW	1	130697079	missense	probably benign
R8704:Pfkfb2	UTSW	1	130698043	missense	probably benign	0.12
R8846:Pfkfb2	UTSW	1	130697911	missense	probably benign
R8884:Pfkfb2	UTSW	1	130706476	missense	probably damaging	0.96
R9033:Pfkfb2	UTSW	1	130698738	nonsense	probably null
R9739:Pfkfb2	UTSW	1	130697078	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCATCCAACCTAAGCTGGTC -3'
(R):5'- AAACCCTTGGTACCTGTGTC -3'

Sequencing Primer
(F):5'- CAACCTAAGCTGGTCTTTCAATCTAG -3'
(R):5'- CCTAAATGGTACTCTGGTAAAACAG -3'

Posted On

2018-11-28