Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Nat10'

541443

Institutional Source

Beutler Lab

Gene Symbol

Nat10

Ensembl Gene

ENSMUSG00000027185

Gene Name

N-acetyltransferase 10

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103721256-103761270 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103734412 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 495 (I495V)

Ref Sequence

ENSEMBL: ENSMUSP00000028608 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028608]

AlphaFold

Q8K224

Predicted Effect

probably benign
Transcript: ENSMUST00000028608
AA Change: I495V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185
AA Change: I495V

Domain	Start	End	E-Value	Type
Pfam:DUF1726	107	201	6.9e-39	PFAM
low complexity region	226	242	N/A	INTRINSIC
Pfam:Helicase_RecD	281	488	1.3e-68	PFAM
Pfam:GNAT_acetyltr_2	528	753	7e-103	PFAM
Pfam:tRNA_bind_2	771	892	3.6e-46	PFAM
low complexity region	999	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA cytidine acetyltransferase involved in histone acetylation, tRNA acetylation, the biosynthesis of 18S rRNA, and the enhancement of nuclear architecture and chromatin organization. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Aars	G	A	8: 111,055,130	V945M	probably benign	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,297,558	D604G	probably damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,707,600	N75D	probably damaging	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 91,286,313		probably null	Het
Scube1	T	C	15: 83,721,876	Y65C	probably damaging	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp1	A	G	4: 98,931,006	E235G	probably damaging	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Nat10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Nat10	APN	2	103725764	critical splice acceptor site	probably null
IGL01062:Nat10	APN	2	103743048	missense	probably damaging	1.00
IGL01524:Nat10	APN	2	103757757	missense	probably damaging	1.00
IGL02553:Nat10	APN	2	103752668	missense	probably damaging	1.00
IGL03040:Nat10	APN	2	103757265	splice site	probably benign
diana	UTSW	2	103725707	missense	probably benign	0.00
Trimmer	UTSW	2	103754150	missense	probably null	1.00
R0106:Nat10	UTSW	2	103757205	missense	probably damaging	1.00
R0106:Nat10	UTSW	2	103757205	missense	probably damaging	1.00
R0268:Nat10	UTSW	2	103727917	splice site	probably benign
R0422:Nat10	UTSW	2	103726729	nonsense	probably null
R0423:Nat10	UTSW	2	103748227	missense	probably damaging	0.98
R0788:Nat10	UTSW	2	103743115	missense	probably damaging	1.00
R0946:Nat10	UTSW	2	103731374	missense	probably damaging	0.99
R1353:Nat10	UTSW	2	103754073	missense	possibly damaging	0.95
R2141:Nat10	UTSW	2	103731303	splice site	probably null
R2142:Nat10	UTSW	2	103731303	splice site	probably null
R2192:Nat10	UTSW	2	103726177	missense	probably benign	0.00
R3904:Nat10	UTSW	2	103726247	splice site	probably benign
R4183:Nat10	UTSW	2	103739813	missense	probably damaging	1.00
R4496:Nat10	UTSW	2	103757739	missense	probably damaging	1.00
R4578:Nat10	UTSW	2	103754072	missense	probably damaging	1.00
R4589:Nat10	UTSW	2	103754070	missense	probably damaging	1.00
R4639:Nat10	UTSW	2	103734889	missense	probably benign	0.00
R4679:Nat10	UTSW	2	103732170	missense	probably damaging	1.00
R4711:Nat10	UTSW	2	103748267	nonsense	probably null
R5089:Nat10	UTSW	2	103757143	unclassified	probably benign
R5103:Nat10	UTSW	2	103757260	missense	probably damaging	0.97
R5108:Nat10	UTSW	2	103732203	missense	probably damaging	0.97
R5134:Nat10	UTSW	2	103743293	missense	probably benign	0.29
R5823:Nat10	UTSW	2	103730267	missense	probably damaging	1.00
R5893:Nat10	UTSW	2	103721839	unclassified	probably benign
R6135:Nat10	UTSW	2	103743316	missense	probably damaging	1.00
R6455:Nat10	UTSW	2	103739886	missense	possibly damaging	0.69
R6592:Nat10	UTSW	2	103754150	missense	probably null	1.00
R7036:Nat10	UTSW	2	103754108	missense	probably benign	0.00
R7063:Nat10	UTSW	2	103748077	missense	probably benign	0.01
R7172:Nat10	UTSW	2	103732969	missense	probably damaging	1.00
R7226:Nat10	UTSW	2	103726753	missense	probably benign	0.01
R7286:Nat10	UTSW	2	103754169	missense	probably benign	0.02
R7448:Nat10	UTSW	2	103748045	missense	probably damaging	0.99
R7470:Nat10	UTSW	2	103734881	missense	probably benign	0.00
R7639:Nat10	UTSW	2	103743090	missense	probably damaging	1.00
R7640:Nat10	UTSW	2	103743090	missense	probably damaging	1.00
R7641:Nat10	UTSW	2	103743090	missense	probably damaging	1.00
R7642:Nat10	UTSW	2	103726786	missense	possibly damaging	0.94
R7766:Nat10	UTSW	2	103725707	missense	probably benign	0.00
R7787:Nat10	UTSW	2	103721863	missense	unknown
R7910:Nat10	UTSW	2	103725145	missense	probably benign	0.26
R8506:Nat10	UTSW	2	103732237	missense	probably benign	0.12
R8774:Nat10	UTSW	2	103731407	missense	probably damaging	0.99
R8774-TAIL:Nat10	UTSW	2	103731407	missense	probably damaging	0.99
R8922:Nat10	UTSW	2	103752593	missense	probably damaging	1.00
R9283:Nat10	UTSW	2	103725747	nonsense	probably null
R9344:Nat10	UTSW	2	103743115	missense	probably damaging	1.00
R9516:Nat10	UTSW	2	103733019	missense	probably damaging	1.00
R9647:Nat10	UTSW	2	103748193	missense	probably benign
R9696:Nat10	UTSW	2	103725695	missense	possibly damaging	0.67
X0024:Nat10	UTSW	2	103727881	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TGTTCTTAGCAGAAACTACAGTGG -3'
(R):5'- TCATGTCACAGATAAAGTGCAGG -3'

Sequencing Primer
(F):5'- CCAATCAGATCTCTGTGAGTTCGAG -3'
(R):5'- GTCACAGATAAAGTGCAGGATTTC -3'

Posted On

2018-11-28