Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Usp1'

541449

Institutional Source

Beutler Lab

Gene Symbol

Usp1

Ensembl Gene

ENSMUSG00000028560

Gene Name

ubiquitin specific peptidase 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.871) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98923810-98935543 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98931006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 235 (E235G)

Ref Sequence

ENSEMBL: ENSMUSP00000088917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030289] [ENSMUST00000091358] [ENSMUST00000125104] [ENSMUST00000169053]

AlphaFold

Q8BJQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000030289
AA Change: E235G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000030289
Gene: ENSMUSG00000028560
AA Change: E235G

Domain	Start	End	E-Value	Type
Pfam:UCH	80	616	9.2e-35	PFAM
Pfam:UCH_1	415	618	1.3e-11	PFAM
Pfam:UCH	723	781	3.9e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091358
AA Change: E235G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000088917
Gene: ENSMUSG00000028560
AA Change: E235G

Domain	Start	End	E-Value	Type
Pfam:UCH	80	622	5e-39	PFAM
Pfam:UCH_1	346	613	2.8e-11	PFAM
low complexity region	765	779	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125104

SMART Domains

Protein: ENSMUSP00000135496
Gene: ENSMUSG00000028560

Domain	Start	End	E-Value	Type
Pfam:UCH	37	150	4.1e-14	PFAM
Pfam:UCH_1	38	80	1.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169053

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: This gene encodes a member of the ubiquitin-specific peptidase family. The encoded protein acts as a catalytic subunit in a heterodimeric deubiquitinating enzyme complex that deubiquitinates Fanconi anemia, complementation group D2, and plays a role in homologous recombination-mediated DNA repair. Disruption of this gene is associated with a Fanconi anemia-like phenotype and genomic instability. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 3, 12, and 15. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice have a high rate of postnatal lethality related to cyanosis. Male survivors are infertile while female survivors have reduced fertility. Both sexes have reduced number of gametes, are sensitive to ionizing radiation, and have decreased numbers of bone marrow cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Aars	G	A	8: 111,055,130	V945M	probably benign	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,297,558	D604G	probably damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Nat10	T	C	2: 103,734,412	I495V	probably benign	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,707,600	N75D	probably damaging	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 91,286,313		probably null	Het
Scube1	T	C	15: 83,721,876	Y65C	probably damaging	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Usp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Usp1	APN	4	98934581	splice site	probably null
IGL02692:Usp1	APN	4	98928960	missense	probably benign	0.00
R1782:Usp1	UTSW	4	98934198	missense	probably damaging	1.00
R1991:Usp1	UTSW	4	98934294	missense	probably benign	0.00
R1992:Usp1	UTSW	4	98934294	missense	probably benign	0.00
R2273:Usp1	UTSW	4	98929842	missense	probably damaging	1.00
R2274:Usp1	UTSW	4	98929842	missense	probably damaging	1.00
R2275:Usp1	UTSW	4	98929842	missense	probably damaging	1.00
R3750:Usp1	UTSW	4	98934120	splice site	probably null
R3886:Usp1	UTSW	4	98929736	missense	probably damaging	1.00
R4014:Usp1	UTSW	4	98934702	missense	probably damaging	1.00
R5141:Usp1	UTSW	4	98934209	missense	probably damaging	1.00
R5304:Usp1	UTSW	4	98934618	missense	probably benign
R5388:Usp1	UTSW	4	98931057	missense	probably benign
R5709:Usp1	UTSW	4	98931123	missense	probably damaging	0.99
R6035:Usp1	UTSW	4	98929845	missense	probably damaging	1.00
R6035:Usp1	UTSW	4	98929845	missense	probably damaging	1.00
R6592:Usp1	UTSW	4	98926519	missense	possibly damaging	0.86
R7117:Usp1	UTSW	4	98928890	missense	possibly damaging	0.59
R7396:Usp1	UTSW	4	98926451	intron	probably benign
R7516:Usp1	UTSW	4	98934119	missense	probably damaging	1.00
R7590:Usp1	UTSW	4	98934252	missense	possibly damaging	0.67
R7828:Usp1	UTSW	4	98932307	missense	probably damaging	1.00
R8050:Usp1	UTSW	4	98928913	missense	probably benign	0.10
R8085:Usp1	UTSW	4	98928341	missense	probably damaging	1.00
R8298:Usp1	UTSW	4	98930899	missense	probably damaging	1.00
R8736:Usp1	UTSW	4	98932868	missense	probably damaging	1.00
R8801:Usp1	UTSW	4	98934611	missense	probably benign
R8844:Usp1	UTSW	4	98934780	missense	probably damaging	1.00
R8887:Usp1	UTSW	4	98930948	missense	probably benign	0.43
R8899:Usp1	UTSW	4	98931110	missense	probably damaging	1.00
R9063:Usp1	UTSW	4	98931152	missense	probably benign	0.00
R9275:Usp1	UTSW	4	98931341	missense	probably damaging	0.98
R9738:Usp1	UTSW	4	98931435	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATGGGAGCCCTTGTGAATGC -3'
(R):5'- TCTTCCAATGGCTGGGATTC -3'

Sequencing Primer
(F):5'- AGCCCTTGTGAATGCGTGAG -3'
(R):5'- GGGATTCCCTGGACAGTTTAACC -3'

Posted On

2018-11-28