Incidental Mutation 'R6956:Usp1'
ID 541449
Institutional Source Beutler Lab
Gene Symbol Usp1
Ensembl Gene ENSMUSG00000028560
Gene Name ubiquitin specific peptidase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 98923810-98935543 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98931006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 235 (E235G)
Ref Sequence ENSEMBL: ENSMUSP00000088917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030289] [ENSMUST00000091358] [ENSMUST00000125104] [ENSMUST00000169053]
AlphaFold Q8BJQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000030289
AA Change: E235G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030289
Gene: ENSMUSG00000028560
AA Change: E235G

DomainStartEndE-ValueType
Pfam:UCH 80 616 9.2e-35 PFAM
Pfam:UCH_1 415 618 1.3e-11 PFAM
Pfam:UCH 723 781 3.9e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091358
AA Change: E235G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088917
Gene: ENSMUSG00000028560
AA Change: E235G

DomainStartEndE-ValueType
Pfam:UCH 80 622 5e-39 PFAM
Pfam:UCH_1 346 613 2.8e-11 PFAM
low complexity region 765 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125104
SMART Domains Protein: ENSMUSP00000135496
Gene: ENSMUSG00000028560

DomainStartEndE-ValueType
Pfam:UCH 37 150 4.1e-14 PFAM
Pfam:UCH_1 38 80 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169053
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the ubiquitin-specific peptidase family. The encoded protein acts as a catalytic subunit in a heterodimeric deubiquitinating enzyme complex that deubiquitinates Fanconi anemia, complementation group D2, and plays a role in homologous recombination-mediated DNA repair. Disruption of this gene is associated with a Fanconi anemia-like phenotype and genomic instability. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 3, 12, and 15. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice have a high rate of postnatal lethality related to cyanosis. Male survivors are infertile while female survivors have reduced fertility. Both sexes have reduced number of gametes, are sensitive to ionizing radiation, and have decreased numbers of bone marrow cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Usp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Usp1 APN 4 98934581 splice site probably null
IGL02692:Usp1 APN 4 98928960 missense probably benign 0.00
R1782:Usp1 UTSW 4 98934198 missense probably damaging 1.00
R1991:Usp1 UTSW 4 98934294 missense probably benign 0.00
R1992:Usp1 UTSW 4 98934294 missense probably benign 0.00
R2273:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2274:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R2275:Usp1 UTSW 4 98929842 missense probably damaging 1.00
R3750:Usp1 UTSW 4 98934120 splice site probably null
R3886:Usp1 UTSW 4 98929736 missense probably damaging 1.00
R4014:Usp1 UTSW 4 98934702 missense probably damaging 1.00
R5141:Usp1 UTSW 4 98934209 missense probably damaging 1.00
R5304:Usp1 UTSW 4 98934618 missense probably benign
R5388:Usp1 UTSW 4 98931057 missense probably benign
R5709:Usp1 UTSW 4 98931123 missense probably damaging 0.99
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6035:Usp1 UTSW 4 98929845 missense probably damaging 1.00
R6592:Usp1 UTSW 4 98926519 missense possibly damaging 0.86
R7117:Usp1 UTSW 4 98928890 missense possibly damaging 0.59
R7396:Usp1 UTSW 4 98926451 intron probably benign
R7516:Usp1 UTSW 4 98934119 missense probably damaging 1.00
R7590:Usp1 UTSW 4 98934252 missense possibly damaging 0.67
R7828:Usp1 UTSW 4 98932307 missense probably damaging 1.00
R8050:Usp1 UTSW 4 98928913 missense probably benign 0.10
R8085:Usp1 UTSW 4 98928341 missense probably damaging 1.00
R8298:Usp1 UTSW 4 98930899 missense probably damaging 1.00
R8736:Usp1 UTSW 4 98932868 missense probably damaging 1.00
R8801:Usp1 UTSW 4 98934611 missense probably benign
R8844:Usp1 UTSW 4 98934780 missense probably damaging 1.00
R8887:Usp1 UTSW 4 98930948 missense probably benign 0.43
R8899:Usp1 UTSW 4 98931110 missense probably damaging 1.00
R9063:Usp1 UTSW 4 98931152 missense probably benign 0.00
R9275:Usp1 UTSW 4 98931341 missense probably damaging 0.98
R9738:Usp1 UTSW 4 98931435 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGGGAGCCCTTGTGAATGC -3'
(R):5'- TCTTCCAATGGCTGGGATTC -3'

Sequencing Primer
(F):5'- AGCCCTTGTGAATGCGTGAG -3'
(R):5'- GGGATTCCCTGGACAGTTTAACC -3'
Posted On 2018-11-28