Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Mphosph9'

541454

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

MMRRC Submission

045067-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124297558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 604 (D604G)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031344
AA Change: D574G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: D574G

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130502

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141203

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

probably damaging
Transcript: ENSMUST00000184951
AA Change: D604G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: D604G

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Meta Mutation Damage Score

0.1573

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Aars	G	A	8: 111,055,130	V945M	probably benign	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Nat10	T	C	2: 103,734,412	I495V	probably benign	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,707,600	N75D	probably damaging	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 91,286,313		probably null	Het
Scube1	T	C	15: 83,721,876	Y65C	probably damaging	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp1	A	G	4: 98,931,006	E235G	probably damaging	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5815:Mphosph9	UTSW	5	124315418	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10
R9603:Mphosph9	UTSW	5	124324952	nonsense	probably null
R9721:Mphosph9	UTSW	5	124298675	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CATAAAAGGCATGGCTTTGTGTTG -3'
(R):5'- ACGGTCCTGAGAGCATCTTTC -3'

Sequencing Primer
(F):5'- AGGCATGGCTTTGTGTTGGTTATAAC -3'
(R):5'- AGAGCATCTTTCCTTCTTACTGACAG -3'

Posted On

2018-11-28