Incidental Mutation 'R6956:Kel'
ID 541455
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene Name Kell blood group
Synonyms CD238
MMRRC Submission 045067-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 41663263-41681268 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 41664907 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 7 (D7A)
Ref Sequence ENSEMBL: ENSMUSP00000142058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000031900] [ENSMUST00000194597]
AlphaFold Q9EQF2
Predicted Effect probably damaging
Transcript: ENSMUST00000031899
AA Change: D619A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: D619A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031900
SMART Domains Protein: ENSMUSP00000031900
Gene: ENSMUSG00000029867

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF4717 37 107 7.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Predicted Effect probably damaging
Transcript: ENSMUST00000194597
AA Change: D7A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866
AA Change: D7A

DomainStartEndE-ValueType
Pfam:Peptidase_M13 16 68 3.6e-10 PFAM
Meta Mutation Damage Score 0.9111 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 G A 8: 111,781,762 (GRCm39) V945M probably benign Het
Amotl2 A G 9: 102,601,967 (GRCm39) T371A probably damaging Het
Bmpr1a A G 14: 34,163,132 (GRCm39) I86T possibly damaging Het
C9 A T 15: 6,474,945 (GRCm39) M35L probably benign Het
Cc2d1a G T 8: 84,862,528 (GRCm39) P661T probably damaging Het
Ccdc202 T A 14: 96,119,869 (GRCm39) W209R probably damaging Het
Dcdc2a T A 13: 25,303,349 (GRCm39) S293R probably benign Het
Dchs2 T A 3: 83,261,233 (GRCm39) N2500K probably benign Het
Dicer1 A G 12: 104,697,282 (GRCm39) S92P probably damaging Het
Dnah7a T A 1: 53,616,446 (GRCm39) I1172F probably benign Het
Dnajc6 A G 4: 101,471,470 (GRCm39) S364G probably damaging Het
Dpp6 A T 5: 27,803,819 (GRCm39) N255I probably damaging Het
Eif2ak4 T C 2: 118,252,748 (GRCm39) I440T probably damaging Het
Fam184b T C 5: 45,688,099 (GRCm39) T937A probably damaging Het
Fam229b T A 10: 39,009,843 (GRCm39) probably null Het
Gbp11 A G 5: 105,476,241 (GRCm39) probably null Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
H2-T3 T A 17: 36,500,263 (GRCm39) Y144F probably damaging Het
Lrrc7 A G 3: 157,994,668 (GRCm39) V166A probably benign Het
Mapt T C 11: 104,209,081 (GRCm39) probably null Het
Marchf3 A G 18: 56,909,053 (GRCm39) V244A probably benign Het
Mboat1 T C 13: 30,422,059 (GRCm39) V396A possibly damaging Het
Mphosph9 T C 5: 124,435,621 (GRCm39) D604G probably damaging Het
Muc16 T C 9: 18,556,322 (GRCm39) T3324A unknown Het
Nalf1 T A 8: 9,820,744 (GRCm39) Q92L probably benign Het
Nat10 T C 2: 103,564,757 (GRCm39) I495V probably benign Het
Or6c208 A T 10: 129,224,166 (GRCm39) K221N probably benign Het
Pfkfb2 T C 1: 130,635,337 (GRCm39) N75D probably damaging Het
Psmd3 T A 11: 98,586,377 (GRCm39) L515Q probably damaging Het
Rpgrip1l A C 8: 92,012,941 (GRCm39) probably null Het
Scube1 T C 15: 83,606,077 (GRCm39) Y65C probably damaging Het
Slc12a4 A G 8: 106,680,484 (GRCm39) F211L probably damaging Het
Socs7 T C 11: 97,267,849 (GRCm39) S327P probably benign Het
Spef2 A T 15: 9,685,021 (GRCm39) D591E probably damaging Het
Sult2a6 T A 7: 13,988,748 (GRCm39) D4V possibly damaging Het
Tdpoz8 T C 3: 92,981,279 (GRCm39) V25A possibly damaging Het
Tdrd9 A G 12: 112,002,788 (GRCm39) probably benign Het
Tgm4 G T 9: 122,893,768 (GRCm39) M155I possibly damaging Het
Togaram2 T C 17: 72,036,183 (GRCm39) V891A probably benign Het
Usp1 A G 4: 98,819,243 (GRCm39) E235G probably damaging Het
Usp2 T A 9: 44,004,053 (GRCm39) V533E probably damaging Het
Vcan T A 13: 89,837,550 (GRCm39) I2665F probably damaging Het
Vmn2r31 G A 7: 7,397,505 (GRCm39) S251L probably benign Het
Vmn2r84 C A 10: 130,225,136 (GRCm39) C458F probably damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41,665,509 (GRCm39) missense probably damaging 1.00
IGL00792:Kel APN 6 41,678,946 (GRCm39) missense probably damaging 1.00
IGL00972:Kel APN 6 41,665,000 (GRCm39) missense possibly damaging 0.62
IGL01121:Kel APN 6 41,679,343 (GRCm39) missense probably benign 0.00
IGL01286:Kel APN 6 41,665,051 (GRCm39) splice site probably null
IGL01461:Kel APN 6 41,678,845 (GRCm39) critical splice donor site probably null
IGL01836:Kel APN 6 41,674,372 (GRCm39) missense possibly damaging 0.50
IGL02037:Kel APN 6 41,674,408 (GRCm39) missense probably benign 0.01
IGL02103:Kel APN 6 41,679,323 (GRCm39) missense probably benign 0.18
IGL02604:Kel APN 6 41,664,516 (GRCm39) missense probably damaging 0.98
IGL03102:Kel APN 6 41,679,917 (GRCm39) missense probably benign 0.00
IGL03274:Kel APN 6 41,664,929 (GRCm39) splice site probably null
IGL03355:Kel APN 6 41,675,821 (GRCm39) critical splice donor site probably null
A4554:Kel UTSW 6 41,674,353 (GRCm39) missense possibly damaging 0.95
R0121:Kel UTSW 6 41,678,998 (GRCm39) unclassified probably benign
R0153:Kel UTSW 6 41,678,877 (GRCm39) missense probably benign 0.08
R0535:Kel UTSW 6 41,667,772 (GRCm39) missense probably null 0.21
R0658:Kel UTSW 6 41,679,965 (GRCm39) missense probably damaging 1.00
R1005:Kel UTSW 6 41,665,551 (GRCm39) missense probably damaging 1.00
R1199:Kel UTSW 6 41,665,525 (GRCm39) missense possibly damaging 0.95
R1272:Kel UTSW 6 41,680,404 (GRCm39) missense probably benign 0.00
R1531:Kel UTSW 6 41,665,560 (GRCm39) missense probably damaging 0.99
R1880:Kel UTSW 6 41,664,479 (GRCm39) missense possibly damaging 0.95
R2102:Kel UTSW 6 41,663,418 (GRCm39) missense possibly damaging 0.86
R2118:Kel UTSW 6 41,666,234 (GRCm39) missense probably benign
R2571:Kel UTSW 6 41,665,001 (GRCm39) missense possibly damaging 0.62
R4209:Kel UTSW 6 41,675,359 (GRCm39) nonsense probably null
R4210:Kel UTSW 6 41,675,359 (GRCm39) nonsense probably null
R4260:Kel UTSW 6 41,663,357 (GRCm39) utr 3 prime probably benign
R4382:Kel UTSW 6 41,675,334 (GRCm39) missense probably benign 0.13
R5023:Kel UTSW 6 41,665,045 (GRCm39) missense probably damaging 1.00
R5033:Kel UTSW 6 41,675,989 (GRCm39) missense probably damaging 1.00
R5239:Kel UTSW 6 41,665,048 (GRCm39) nonsense probably null
R5431:Kel UTSW 6 41,675,354 (GRCm39) missense probably benign 0.23
R5742:Kel UTSW 6 41,675,961 (GRCm39) missense probably damaging 1.00
R5745:Kel UTSW 6 41,675,961 (GRCm39) missense probably damaging 1.00
R5746:Kel UTSW 6 41,675,961 (GRCm39) missense probably damaging 1.00
R5978:Kel UTSW 6 41,664,979 (GRCm39) missense probably benign 0.00
R6023:Kel UTSW 6 41,674,409 (GRCm39) missense probably benign
R6109:Kel UTSW 6 41,665,796 (GRCm39) missense probably benign 0.06
R6125:Kel UTSW 6 41,667,720 (GRCm39) missense probably damaging 1.00
R6319:Kel UTSW 6 41,679,381 (GRCm39) missense probably benign 0.05
R6368:Kel UTSW 6 41,665,785 (GRCm39) nonsense probably null
R6864:Kel UTSW 6 41,680,694 (GRCm39) critical splice donor site probably null
R7644:Kel UTSW 6 41,667,742 (GRCm39) missense probably benign 0.03
R7938:Kel UTSW 6 41,675,310 (GRCm39) missense probably benign 0.06
R8028:Kel UTSW 6 41,675,958 (GRCm39) missense probably benign 0.21
R8082:Kel UTSW 6 41,680,424 (GRCm39) missense possibly damaging 0.94
R8465:Kel UTSW 6 41,666,472 (GRCm39) critical splice donor site probably null
R9158:Kel UTSW 6 41,664,905 (GRCm39) missense probably benign 0.10
R9518:Kel UTSW 6 41,679,334 (GRCm39) missense probably damaging 1.00
R9726:Kel UTSW 6 41,678,971 (GRCm39) missense probably damaging 1.00
R9769:Kel UTSW 6 41,678,990 (GRCm39) missense probably damaging 1.00
X0028:Kel UTSW 6 41,675,285 (GRCm39) missense probably damaging 0.99
Z1176:Kel UTSW 6 41,664,506 (GRCm39) missense probably damaging 1.00
Z1177:Kel UTSW 6 41,666,493 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTACAGATGTCTTAGTAGGTGGG -3'
(R):5'- CAGCCAGGTTAGTCTACGATATCC -3'

Sequencing Primer
(F):5'- CTTAGTAGGTGGGGGATCTACAGC -3'
(R):5'- ACGATATCCCTTATATTCCAATGACC -3'
Posted On 2018-11-28