Incidental Mutation 'R6956:Cc2d1a'
ID541459
Institutional Source Beutler Lab
Gene Symbol Cc2d1a
Ensembl Gene ENSMUSG00000036686
Gene Namecoiled-coil and C2 domain containing 1A
SynonymsFreud-1, Tape
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R6956 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84132828-84147936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84135899 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 661 (P661T)
Ref Sequence ENSEMBL: ENSMUSP00000046449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000093380] [ENSMUST00000117424]
Predicted Effect probably damaging
Transcript: ENSMUST00000040383
AA Change: P661T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686
AA Change: P661T

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093380
SMART Domains Protein: ENSMUSP00000091073
Gene: ENSMUSG00000012889

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 38 71 1.91e0 SMART
LRR 70 89 1.81e2 SMART
LRR 90 115 1.76e-1 SMART
LRR 116 139 1.19e2 SMART
LRR 162 186 1.06e1 SMART
LRR 191 210 5.42e1 SMART
LRR 211 231 1.66e1 SMART
LRR 233 257 3.98e1 SMART
LRR_TYP 258 281 7.9e-4 SMART
LRR 304 328 9.24e1 SMART
LRR_TYP 329 352 4.72e-2 SMART
LRR 375 399 2.61e2 SMART
LRR_TYP 400 423 2.61e-4 SMART
LRR 424 444 3.18e1 SMART
LRR 445 470 3.27e1 SMART
LRR_TYP 471 494 3.63e-3 SMART
LRR 495 515 1.97e1 SMART
LRR 516 541 2.03e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117424
AA Change: P615T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686
AA Change: P615T

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in nonsyndromic mental retardation-3.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, reduced body weight, hunched posture, respiratory distress, increased sensitivity of neurons to hydrogen peroxide, reduced dendrite length, abnormal brain vasculature and reduced synaptic number and density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Cc2d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Cc2d1a APN 8 84140265 missense possibly damaging 0.87
IGL01126:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01129:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01133:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01135:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01953:Cc2d1a APN 8 84143978 missense probably benign 0.00
IGL02216:Cc2d1a APN 8 84139313 nonsense probably null
IGL03131:Cc2d1a APN 8 84143427 missense probably damaging 1.00
IGL03268:Cc2d1a APN 8 84133525 missense probably damaging 1.00
IGL03401:Cc2d1a APN 8 84134629 missense probably benign 0.00
R0313:Cc2d1a UTSW 8 84136969 missense probably benign 0.38
R0811:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0812:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0893:Cc2d1a UTSW 8 84140839 splice site probably benign
R1440:Cc2d1a UTSW 8 84133975 critical splice donor site probably null
R1625:Cc2d1a UTSW 8 84139372 missense probably damaging 1.00
R2183:Cc2d1a UTSW 8 84140399 missense probably damaging 1.00
R5155:Cc2d1a UTSW 8 84141126 missense probably benign 0.00
R5959:Cc2d1a UTSW 8 84133503 nonsense probably null
R6046:Cc2d1a UTSW 8 84136942 missense possibly damaging 0.81
R6386:Cc2d1a UTSW 8 84138537 missense probably damaging 0.96
R6992:Cc2d1a UTSW 8 84134913 missense probably damaging 1.00
R7156:Cc2d1a UTSW 8 84135760 missense possibly damaging 0.69
R7396:Cc2d1a UTSW 8 84143745 splice site probably null
R7456:Cc2d1a UTSW 8 84140239 critical splice donor site probably null
R7787:Cc2d1a UTSW 8 84133515 missense possibly damaging 0.94
RF007:Cc2d1a UTSW 8 84134669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAATGATCAGGACCCAG -3'
(R):5'- ATGCCTAGCCCTACATCCTG -3'

Sequencing Primer
(F):5'- AGGCCAGATGTACACTTCCTG -3'
(R):5'- ACATCCTGACTGTGAAGTCTG -3'
Posted On2018-11-28