Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Aars'

541462

Institutional Source

Beutler Lab

Gene Symbol

Aars

Ensembl Gene

ENSMUSG00000031960

Gene Name

alanyl-tRNA synthetase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111033144-111057664 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 111055130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 945 (V945M)

Ref Sequence

ENSEMBL: ENSMUSP00000034441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034441] [ENSMUST00000190778] [ENSMUST00000191030] [ENSMUST00000191469] [ENSMUST00000210390]

AlphaFold

Q8BGQ7

Predicted Effect

probably benign
Transcript: ENSMUST00000034441
AA Change: V945M

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000034441
Gene: ENSMUSG00000031960
AA Change: V945M

Domain	Start	End	E-Value	Type
Pfam:tRNA-synt_2c	9	597	9.2e-228	PFAM
tRNA_SAD	694	753	5.97e-18	SMART
Pfam:DHHA1	885	957	1.6e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190778

SMART Domains

Protein: ENSMUSP00000139789
Gene: ENSMUSG00000033633

Domain	Start	End	E-Value	Type
low complexity region	59	80	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191030

SMART Domains

Protein: ENSMUSP00000139569
Gene: ENSMUSG00000033633

Domain	Start	End	E-Value	Type
low complexity region	59	80	N/A	INTRINSIC
SCP	100	248	5.76e-19	SMART
EGF	282	319	5.32e-1	SMART
EGF_like	321	350	4.83e1	SMART
CLECT	355	491	4.65e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191469

SMART Domains

Protein: ENSMUSP00000139515
Gene: ENSMUSG00000033633

Domain	Start	End	E-Value	Type
low complexity region	85	96	N/A	INTRINSIC
SCP	130	278	5.76e-19	SMART
EGF	312	349	5.32e-1	SMART
EGF_like	351	380	4.83e1	SMART
CLECT	385	521	4.65e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000210390

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous point mutation (A734E) exhibit a rough sticky coat, follicular dystrophy, patchy hair loss, progressive ataxia, and Purkinje cell degeneration. Homozygotes for a targeted point mutation (C723A) die by mid-gestation, while heterozygotes show mild Purkinje cell loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,297,558	D604G	probably damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Nat10	T	C	2: 103,734,412	I495V	probably benign	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,707,600	N75D	probably damaging	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 91,286,313		probably null	Het
Scube1	T	C	15: 83,721,876	Y65C	probably damaging	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp1	A	G	4: 98,931,006	E235G	probably damaging	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Aars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00478:Aars	APN	8	111047972	missense	possibly damaging	0.86
IGL00731:Aars	APN	8	111044869	splice site	probably benign
IGL00826:Aars	APN	8	111040300	missense	probably damaging	1.00
IGL01521:Aars	APN	8	111043787	missense	possibly damaging	0.85
IGL01885:Aars	APN	8	111047943	missense	possibly damaging	0.89
IGL01920:Aars	APN	8	111043246	missense	probably damaging	1.00
IGL01934:Aars	APN	8	111048018	missense	probably damaging	0.98
IGL02013:Aars	APN	8	111047066	missense	probably damaging	0.99
IGL02489:Aars	APN	8	111054215	unclassified	probably benign
IGL02683:Aars	APN	8	111052531	unclassified	probably benign
IGL03084:Aars	APN	8	111041629	missense	probably damaging	1.00
H8786:Aars	UTSW	8	111045555	missense	probably benign
R0037:Aars	UTSW	8	111043259	missense	possibly damaging	0.77
R0049:Aars	UTSW	8	111052451	missense	possibly damaging	0.75
R0049:Aars	UTSW	8	111052451	missense	possibly damaging	0.75
R0577:Aars	UTSW	8	111043278	missense	probably benign	0.10
R1183:Aars	UTSW	8	111041574	nonsense	probably null
R1642:Aars	UTSW	8	111043250	missense	possibly damaging	0.77
R1829:Aars	UTSW	8	111042706	missense	probably damaging	1.00
R1857:Aars	UTSW	8	111040157	missense	probably damaging	0.99
R2190:Aars	UTSW	8	111040153	missense	probably damaging	1.00
R2303:Aars	UTSW	8	111052502	missense	possibly damaging	0.84
R3918:Aars	UTSW	8	111040142	missense	probably damaging	1.00
R4001:Aars	UTSW	8	111041602	missense	probably damaging	1.00
R4434:Aars	UTSW	8	111054621	missense	probably null	0.74
R4909:Aars	UTSW	8	111055083	missense	probably damaging	1.00
R4970:Aars	UTSW	8	111043679	missense	probably benign	0.00
R5639:Aars	UTSW	8	111043234	missense	probably benign	0.01
R5991:Aars	UTSW	8	111050400	missense	probably damaging	1.00
R6403:Aars	UTSW	8	111042249	missense	possibly damaging	0.87
R6521:Aars	UTSW	8	111043336	missense	probably benign	0.01
R7378:Aars	UTSW	8	111042342	missense	probably damaging	1.00
R7625:Aars	UTSW	8	111046955	missense	probably damaging	0.99
R7745:Aars	UTSW	8	111041657	missense	probably damaging	1.00
R7792:Aars	UTSW	8	111043264	missense	possibly damaging	0.75
R7860:Aars	UTSW	8	111049861	missense	probably benign	0.16
R8109:Aars	UTSW	8	111040652	missense	probably benign
R8197:Aars	UTSW	8	111053996	missense	probably benign	0.44
R8322:Aars	UTSW	8	111045528	missense	possibly damaging	0.93
R8343:Aars	UTSW	8	111040729	missense	probably damaging	1.00
R8683:Aars	UTSW	8	111042249	missense	possibly damaging	0.87
R8783:Aars	UTSW	8	111049883	missense	probably benign	0.01
R8977:Aars	UTSW	8	111040217	missense	probably damaging	1.00
R9087:Aars	UTSW	8	111041537	missense	probably damaging	1.00
R9401:Aars	UTSW	8	111054153	missense	probably benign	0.24
R9561:Aars	UTSW	8	111036983	missense	probably damaging	1.00
R9576:Aars	UTSW	8	111041664	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTCTGTGGTAGCATCACACATG -3'
(R):5'- AGGTCCCATGACTCCAATGTC -3'

Sequencing Primer
(F):5'- CACACATGATACAAATGGATGTTGG -3'
(R):5'- GACTCCAATGTCTTCGTGGCG -3'

Posted On

2018-11-28