Incidental Mutation 'R6956:Usp2'
ID 541464
Institutional Source Beutler Lab
Gene Symbol Usp2
Ensembl Gene ENSMUSG00000032010
Gene Name ubiquitin specific peptidase 2
Synonyms ubp41, B930035K21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 44067021-44095627 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44092756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 533 (V533E)
Ref Sequence ENSEMBL: ENSMUSP00000135018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034508] [ENSMUST00000065379] [ENSMUST00000065461] [ENSMUST00000114830] [ENSMUST00000162126] [ENSMUST00000175816] [ENSMUST00000176416] [ENSMUST00000177054] [ENSMUST00000185479]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034508
AA Change: V533E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034508
Gene: ENSMUSG00000032010
AA Change: V533E

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 8.4e-75 PFAM
Pfam:UCH_1 281 592 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065461
AA Change: V310E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070264
Gene: ENSMUSG00000032010
AA Change: V310E

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 57 387 7.5e-79 PFAM
Pfam:UCH_1 58 369 2.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114830
AA Change: V533E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110479
Gene: ENSMUSG00000032010
AA Change: V533E

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175816
Predicted Effect probably damaging
Transcript: ENSMUST00000176416
AA Change: V307E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135482
Gene: ENSMUSG00000032010
AA Change: V307E

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 54 384 7.3e-79 PFAM
Pfam:UCH_1 55 366 2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177054
AA Change: V533E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135018
Gene: ENSMUSG00000032010
AA Change: V533E

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Meta Mutation Damage Score 0.8662 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null mutation display severely reduced male fertility with defects in sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Usp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Usp2 APN 9 44089165 nonsense probably null
IGL01574:Usp2 APN 9 44093803 missense probably damaging 1.00
IGL02103:Usp2 APN 9 44089128 intron probably benign
IGL02391:Usp2 APN 9 44091227 missense probably damaging 1.00
R0385:Usp2 UTSW 9 44092750 missense probably damaging 0.99
R0555:Usp2 UTSW 9 44092784 missense probably damaging 1.00
R0614:Usp2 UTSW 9 44092492 nonsense probably null
R1553:Usp2 UTSW 9 44092155 missense probably damaging 0.99
R1851:Usp2 UTSW 9 44075966 missense probably benign 0.00
R2437:Usp2 UTSW 9 44092148 missense probably damaging 0.98
R3962:Usp2 UTSW 9 44075657 missense possibly damaging 0.82
R4392:Usp2 UTSW 9 44091259 missense probably damaging 1.00
R4411:Usp2 UTSW 9 44091063 missense probably damaging 1.00
R4894:Usp2 UTSW 9 44075828 missense probably benign 0.03
R4960:Usp2 UTSW 9 44075813 missense probably damaging 1.00
R5482:Usp2 UTSW 9 44089183 critical splice donor site probably null
R5496:Usp2 UTSW 9 44085208 missense possibly damaging 0.95
R5932:Usp2 UTSW 9 44092333 missense probably benign
R7007:Usp2 UTSW 9 44090042 missense probably damaging 1.00
R7224:Usp2 UTSW 9 44075969 missense possibly damaging 0.95
R7635:Usp2 UTSW 9 44067222 critical splice donor site probably null
R7707:Usp2 UTSW 9 44073460 splice site probably null
R8493:Usp2 UTSW 9 44076053 missense possibly damaging 0.85
R8744:Usp2 UTSW 9 44087213 intron probably benign
R8888:Usp2 UTSW 9 44075597 missense probably benign 0.18
R9035:Usp2 UTSW 9 44075879 missense probably damaging 1.00
R9650:Usp2 UTSW 9 44089179 missense probably damaging 1.00
R9667:Usp2 UTSW 9 44092190 critical splice donor site probably null
RF007:Usp2 UTSW 9 44089121 critical splice acceptor site probably benign
RF012:Usp2 UTSW 9 44089130 critical splice acceptor site probably benign
RF015:Usp2 UTSW 9 44089109 critical splice acceptor site probably benign
RF036:Usp2 UTSW 9 44089124 critical splice acceptor site probably benign
RF046:Usp2 UTSW 9 44089111 critical splice acceptor site probably benign
RF051:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
RF053:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TATCCTTGACTCCCAGGGTG -3'
(R):5'- GGTCAAAGGGGCATCTTGAC -3'

Sequencing Primer
(F):5'- CAGGGTGGGGAGCTGATTTTTG -3'
(R):5'- AGGGGCATCTTGACAGTCAATTCTC -3'
Posted On 2018-11-28