Incidental Mutation 'R6956:Amotl2'
ID 541465
Institutional Source Beutler Lab
Gene Symbol Amotl2
Ensembl Gene ENSMUSG00000032531
Gene Name angiomotin-like 2
Synonyms Lccp, MASCOT
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 102716672-102733418 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102724768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 371 (T371A)
Ref Sequence ENSEMBL: ENSMUSP00000035121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035121] [ENSMUST00000134483] [ENSMUST00000142011] [ENSMUST00000145913] [ENSMUST00000145937] [ENSMUST00000153911] [ENSMUST00000153965] [ENSMUST00000156485] [ENSMUST00000190047]
AlphaFold Q8K371
Predicted Effect probably damaging
Transcript: ENSMUST00000035121
AA Change: T371A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035121
Gene: ENSMUSG00000032531
AA Change: T371A

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 688 2.3e-98 PFAM
low complexity region 698 710 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000115845
Gene: ENSMUSG00000032531
AA Change: T185A

DomainStartEndE-ValueType
low complexity region 30 50 N/A INTRINSIC
Blast:PAC 134 175 8e-13 BLAST
low complexity region 204 218 N/A INTRINSIC
Pfam:Angiomotin_C 260 470 4.9e-98 PFAM
low complexity region 480 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134483
Predicted Effect possibly damaging
Transcript: ENSMUST00000142011
AA Change: T371A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120378
Gene: ENSMUSG00000032531
AA Change: T371A

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
low complexity region 192 215 N/A INTRINSIC
low complexity region 248 268 N/A INTRINSIC
Blast:PAC 352 393 1e-12 BLAST
low complexity region 422 436 N/A INTRINSIC
Pfam:Angiomotin_C 478 686 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145913
SMART Domains Protein: ENSMUSP00000118126
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145937
SMART Domains Protein: ENSMUSP00000114950
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153911
SMART Domains Protein: ENSMUSP00000119903
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 56 76 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153965
AA Change: T404A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121113
Gene: ENSMUSG00000032531
AA Change: T404A

DomainStartEndE-ValueType
low complexity region 66 86 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 190 203 N/A INTRINSIC
low complexity region 225 248 N/A INTRINSIC
low complexity region 281 301 N/A INTRINSIC
Blast:PAC 385 426 1e-12 BLAST
low complexity region 455 469 N/A INTRINSIC
Pfam:Angiomotin_C 511 719 3.7e-94 PFAM
low complexity region 731 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156485
SMART Domains Protein: ENSMUSP00000116554
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
low complexity region 33 53 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190047
SMART Domains Protein: ENSMUSP00000140688
Gene: ENSMUSG00000032531

DomainStartEndE-ValueType
coiled coil region 1 114 N/A INTRINSIC
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiomotin is a protein that binds angiostatin, a circulating inhibitor of the formation of new blood vessels (angiogenesis). Angiomotin mediates angiostatin inhibition of endothelial cell migration and tube formation in vitro. The protein encoded by this gene is related to angiomotin and is a member of the motin protein family. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Conditional homozygous knockout in endothelial cells during embryonic development leads to aortic restriction in the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Amotl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Amotl2 APN 9 102725117 missense probably damaging 1.00
IGL02207:Amotl2 APN 9 102724697 missense probably damaging 1.00
R0471:Amotl2 UTSW 9 102720519 missense probably damaging 0.98
R1420:Amotl2 UTSW 9 102724783 missense possibly damaging 0.91
R1483:Amotl2 UTSW 9 102730897 missense probably benign 0.16
R1525:Amotl2 UTSW 9 102728568 missense probably damaging 1.00
R1661:Amotl2 UTSW 9 102730096 missense probably damaging 0.99
R1945:Amotl2 UTSW 9 102720554 missense probably benign
R2113:Amotl2 UTSW 9 102724723 nonsense probably null
R2157:Amotl2 UTSW 9 102730589 unclassified probably benign
R4084:Amotl2 UTSW 9 102724685 critical splice acceptor site probably null
R4726:Amotl2 UTSW 9 102723819 missense probably benign 0.00
R4755:Amotl2 UTSW 9 102720480 missense probably damaging 1.00
R4782:Amotl2 UTSW 9 102720123 critical splice donor site probably null
R4819:Amotl2 UTSW 9 102730071 missense probably damaging 1.00
R5048:Amotl2 UTSW 9 102723798 missense probably benign 0.00
R5328:Amotl2 UTSW 9 102723768 missense probably benign
R5894:Amotl2 UTSW 9 102725172 missense possibly damaging 0.79
R7304:Amotl2 UTSW 9 102728350 missense probably damaging 1.00
R7390:Amotl2 UTSW 9 102731690 missense probably damaging 1.00
R7474:Amotl2 UTSW 9 102730111 missense probably benign 0.00
R7816:Amotl2 UTSW 9 102731654 missense probably benign 0.43
R7967:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7969:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7970:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7971:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7972:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R7973:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8017:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8019:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8045:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8046:Amotl2 UTSW 9 102723769 missense probably benign 0.00
R8131:Amotl2 UTSW 9 102720416 missense probably damaging 1.00
R8754:Amotl2 UTSW 9 102720159 missense possibly damaging 0.53
R8813:Amotl2 UTSW 9 102730092 missense probably damaging 1.00
R9071:Amotl2 UTSW 9 102718693 start gained probably benign
R9399:Amotl2 UTSW 9 102729332 missense probably damaging 0.99
X0022:Amotl2 UTSW 9 102729470 missense probably damaging 1.00
Z1088:Amotl2 UTSW 9 102723698 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TAAGAGGCTGCAGTCCTGTG -3'
(R):5'- GATTATAAGGAAGTCCCAGCTCAG -3'

Sequencing Primer
(F):5'- GTCCTGTGGCAATCTCAGTAAAGTC -3'
(R):5'- GGCTAATGTAGGCCTCTATAGCTCAG -3'
Posted On 2018-11-28