Incidental Mutation 'R6956:Tgm4'
ID 541466
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Name transglutaminase 4 (prostate)
Synonyms Eapa1, 9530008N10Rik, experimental autoimmune prostatitis antigen 1
MMRRC Submission 045067-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 122863806-122896623 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 122893768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 155 (M155I)
Ref Sequence ENSEMBL: ENSMUSP00000149120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000140497] [ENSMUST00000215247] [ENSMUST00000217607]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026893
AA Change: M579I

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787
AA Change: M579I

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140497
SMART Domains Protein: ENSMUSP00000122604
Gene: ENSMUSG00000025786

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215247
AA Change: M155I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 G A 8: 111,781,762 (GRCm39) V945M probably benign Het
Amotl2 A G 9: 102,601,967 (GRCm39) T371A probably damaging Het
Bmpr1a A G 14: 34,163,132 (GRCm39) I86T possibly damaging Het
C9 A T 15: 6,474,945 (GRCm39) M35L probably benign Het
Cc2d1a G T 8: 84,862,528 (GRCm39) P661T probably damaging Het
Ccdc202 T A 14: 96,119,869 (GRCm39) W209R probably damaging Het
Dcdc2a T A 13: 25,303,349 (GRCm39) S293R probably benign Het
Dchs2 T A 3: 83,261,233 (GRCm39) N2500K probably benign Het
Dicer1 A G 12: 104,697,282 (GRCm39) S92P probably damaging Het
Dnah7a T A 1: 53,616,446 (GRCm39) I1172F probably benign Het
Dnajc6 A G 4: 101,471,470 (GRCm39) S364G probably damaging Het
Dpp6 A T 5: 27,803,819 (GRCm39) N255I probably damaging Het
Eif2ak4 T C 2: 118,252,748 (GRCm39) I440T probably damaging Het
Fam184b T C 5: 45,688,099 (GRCm39) T937A probably damaging Het
Fam229b T A 10: 39,009,843 (GRCm39) probably null Het
Gbp11 A G 5: 105,476,241 (GRCm39) probably null Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
H2-T3 T A 17: 36,500,263 (GRCm39) Y144F probably damaging Het
Kel T G 6: 41,664,907 (GRCm39) D7A probably damaging Het
Lrrc7 A G 3: 157,994,668 (GRCm39) V166A probably benign Het
Mapt T C 11: 104,209,081 (GRCm39) probably null Het
Marchf3 A G 18: 56,909,053 (GRCm39) V244A probably benign Het
Mboat1 T C 13: 30,422,059 (GRCm39) V396A possibly damaging Het
Mphosph9 T C 5: 124,435,621 (GRCm39) D604G probably damaging Het
Muc16 T C 9: 18,556,322 (GRCm39) T3324A unknown Het
Nalf1 T A 8: 9,820,744 (GRCm39) Q92L probably benign Het
Nat10 T C 2: 103,564,757 (GRCm39) I495V probably benign Het
Or6c208 A T 10: 129,224,166 (GRCm39) K221N probably benign Het
Pfkfb2 T C 1: 130,635,337 (GRCm39) N75D probably damaging Het
Psmd3 T A 11: 98,586,377 (GRCm39) L515Q probably damaging Het
Rpgrip1l A C 8: 92,012,941 (GRCm39) probably null Het
Scube1 T C 15: 83,606,077 (GRCm39) Y65C probably damaging Het
Slc12a4 A G 8: 106,680,484 (GRCm39) F211L probably damaging Het
Socs7 T C 11: 97,267,849 (GRCm39) S327P probably benign Het
Spef2 A T 15: 9,685,021 (GRCm39) D591E probably damaging Het
Sult2a6 T A 7: 13,988,748 (GRCm39) D4V possibly damaging Het
Tdpoz8 T C 3: 92,981,279 (GRCm39) V25A possibly damaging Het
Tdrd9 A G 12: 112,002,788 (GRCm39) probably benign Het
Togaram2 T C 17: 72,036,183 (GRCm39) V891A probably benign Het
Usp1 A G 4: 98,819,243 (GRCm39) E235G probably damaging Het
Usp2 T A 9: 44,004,053 (GRCm39) V533E probably damaging Het
Vcan T A 13: 89,837,550 (GRCm39) I2665F probably damaging Het
Vmn2r31 G A 7: 7,397,505 (GRCm39) S251L probably benign Het
Vmn2r84 C A 10: 130,225,136 (GRCm39) C458F probably damaging Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 122,891,447 (GRCm39) unclassified probably benign
IGL01402:Tgm4 APN 9 122,880,519 (GRCm39) missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 122,885,531 (GRCm39) missense probably damaging 1.00
IGL02120:Tgm4 APN 9 122,875,594 (GRCm39) missense probably damaging 0.98
IGL03130:Tgm4 APN 9 122,885,580 (GRCm39) missense probably damaging 1.00
IGL03188:Tgm4 APN 9 122,874,101 (GRCm39) missense probably null 0.06
R0329:Tgm4 UTSW 9 122,877,622 (GRCm39) critical splice donor site probably null
R0480:Tgm4 UTSW 9 122,891,484 (GRCm39) missense probably benign
R0644:Tgm4 UTSW 9 122,880,523 (GRCm39) missense probably damaging 1.00
R0990:Tgm4 UTSW 9 122,875,576 (GRCm39) missense probably benign 0.02
R1604:Tgm4 UTSW 9 122,874,129 (GRCm39) missense probably benign 0.39
R1644:Tgm4 UTSW 9 122,880,481 (GRCm39) missense probably damaging 1.00
R2056:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2058:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2059:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2076:Tgm4 UTSW 9 122,880,160 (GRCm39) missense probably benign 0.24
R2437:Tgm4 UTSW 9 122,877,614 (GRCm39) nonsense probably null
R4392:Tgm4 UTSW 9 122,895,817 (GRCm39) missense probably benign 0.10
R4407:Tgm4 UTSW 9 122,885,595 (GRCm39) missense probably damaging 1.00
R4752:Tgm4 UTSW 9 122,880,451 (GRCm39) missense probably damaging 1.00
R5288:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5365:Tgm4 UTSW 9 122,895,866 (GRCm39) missense probably damaging 1.00
R5386:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5790:Tgm4 UTSW 9 122,890,808 (GRCm39) missense probably damaging 0.98
R5890:Tgm4 UTSW 9 122,890,703 (GRCm39) missense probably damaging 1.00
R6102:Tgm4 UTSW 9 122,885,600 (GRCm39) missense probably benign
R6358:Tgm4 UTSW 9 122,885,583 (GRCm39) missense probably damaging 1.00
R6966:Tgm4 UTSW 9 122,880,207 (GRCm39) missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 122,869,525 (GRCm39) missense probably damaging 1.00
R7258:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7313:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7369:Tgm4 UTSW 9 122,885,749 (GRCm39) critical splice donor site probably null
R7802:Tgm4 UTSW 9 122,880,401 (GRCm39) intron probably benign
R8219:Tgm4 UTSW 9 122,874,117 (GRCm39) missense probably benign
R8787:Tgm4 UTSW 9 122,890,910 (GRCm39) missense probably damaging 1.00
R8936:Tgm4 UTSW 9 122,869,541 (GRCm39) missense possibly damaging 0.92
R9045:Tgm4 UTSW 9 122,877,616 (GRCm39) missense possibly damaging 0.94
R9328:Tgm4 UTSW 9 122,885,697 (GRCm39) missense possibly damaging 0.93
R9359:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9403:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9471:Tgm4 UTSW 9 122,869,444 (GRCm39) missense probably benign
R9746:Tgm4 UTSW 9 122,875,634 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTCTGGCAGGACTAGAGAG -3'
(R):5'- AGGGGTTTACATCTCAAAAGTATGG -3'

Sequencing Primer
(F):5'- TCTGGCAGGACTAGAGAGGTAAGC -3'
(R):5'- GCACAGGTATATGTTGGGAAGACTC -3'
Posted On 2018-11-28