Incidental Mutation 'R6956:Socs7'
ID 541469
Institutional Source Beutler Lab
Gene Symbol Socs7
Ensembl Gene ENSMUSG00000038485
Gene Name suppressor of cytokine signaling 7
Synonyms Nap4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 97362551-97398542 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97377023 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 327 (S327P)
Ref Sequence ENSEMBL: ENSMUSP00000040896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045540]
AlphaFold Q8VHQ2
Predicted Effect probably benign
Transcript: ENSMUST00000045540
AA Change: S327P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040896
Gene: ENSMUSG00000038485
AA Change: S327P

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 76 104 N/A INTRINSIC
low complexity region 113 128 N/A INTRINSIC
low complexity region 136 168 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
low complexity region 298 317 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
SH2 396 482 1.89e-19 SMART
SOCS 507 550 3.07e-19 SMART
SOCS_box 513 549 7.37e-9 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Homozygous null mice display partial penetrance of hydroencephaly, premature death, intracranial hemorrhage, abnormally large islets of Langerhans and fully penetrant disorganization of the subcommissural organ and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Socs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03330:Socs7 APN 11 97378552 missense probably damaging 1.00
Dunn UTSW 11 97373124 missense probably benign 0.15
R2136:Socs7 UTSW 11 97373107 missense possibly damaging 0.72
R2145:Socs7 UTSW 11 97373124 missense probably benign 0.15
R4841:Socs7 UTSW 11 97377003 missense possibly damaging 0.95
R4842:Socs7 UTSW 11 97377003 missense possibly damaging 0.95
R5049:Socs7 UTSW 11 97378643 missense probably benign 0.08
R5302:Socs7 UTSW 11 97389199 missense probably damaging 1.00
R5330:Socs7 UTSW 11 97378026 missense possibly damaging 0.83
R5331:Socs7 UTSW 11 97378026 missense possibly damaging 0.83
R7448:Socs7 UTSW 11 97377091 missense possibly damaging 0.84
R7677:Socs7 UTSW 11 97389642 missense probably benign 0.25
R8419:Socs7 UTSW 11 97363339 missense probably benign 0.14
R9422:Socs7 UTSW 11 97363147 missense possibly damaging 0.85
R9602:Socs7 UTSW 11 97377011 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GACTGAGCTGCTTAGGGATAC -3'
(R):5'- GTTCTAGTCCAACCACAGGG -3'

Sequencing Primer
(F):5'- CTTCTAAGCAAGCACAGCTGATTGG -3'
(R):5'- GATGGAGACTGAAGCTTTCTCC -3'
Posted On 2018-11-28