Incidental Mutation 'R6956:Psmd3'
ID 541470
Institutional Source Beutler Lab
Gene Symbol Psmd3
Ensembl Gene ENSMUSG00000017221
Gene Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Synonyms Psd3, AntP91a, Tstap91a
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 98682554-98695979 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98695551 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 515 (L515Q)
Ref Sequence ENSEMBL: ENSMUSP00000017365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017365]
AlphaFold P14685
Predicted Effect probably damaging
Transcript: ENSMUST00000017365
AA Change: L515Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017365
Gene: ENSMUSG00000017221
AA Change: L515Q

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
PAM 217 389 1.07e-68 SMART
PINT 389 479 3.26e-27 SMART
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123676
SMART Domains Protein: ENSMUSP00000116968
Gene: ENSMUSG00000017221

DomainStartEndE-ValueType
PAM 2 198 2.1e-62 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the proteasome subunit S3 family that functions as one of the non-ATPase subunits of the 19S regulator lid. Single nucleotide polymorphisms in this gene are associated with neutrophil count. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Psmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Psmd3 APN 11 98685568 missense probably benign 0.06
IGL01353:Psmd3 APN 11 98690600 missense probably benign 0.05
R1368:Psmd3 UTSW 11 98682920 missense probably damaging 1.00
R1563:Psmd3 UTSW 11 98694225 missense probably damaging 1.00
R2258:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R2259:Psmd3 UTSW 11 98690964 missense probably benign 0.18
R3606:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R3607:Psmd3 UTSW 11 98690954 missense probably damaging 1.00
R4616:Psmd3 UTSW 11 98682926 missense probably benign 0.00
R4833:Psmd3 UTSW 11 98687760 missense probably damaging 1.00
R5033:Psmd3 UTSW 11 98682824 missense probably damaging 1.00
R5585:Psmd3 UTSW 11 98682881 missense possibly damaging 0.45
R5687:Psmd3 UTSW 11 98693669 missense probably damaging 1.00
R5929:Psmd3 UTSW 11 98695596 missense probably damaging 1.00
R6028:Psmd3 UTSW 11 98685665 missense probably damaging 0.99
R6240:Psmd3 UTSW 11 98693653 missense probably damaging 0.98
R6449:Psmd3 UTSW 11 98685640 missense probably benign
R7009:Psmd3 UTSW 11 98682766 missense probably benign 0.04
R7051:Psmd3 UTSW 11 98682833 missense possibly damaging 0.68
R7401:Psmd3 UTSW 11 98685640 missense probably benign
R7449:Psmd3 UTSW 11 98695551 missense probably damaging 1.00
R7549:Psmd3 UTSW 11 98690961 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CCTACAACAAGGACCTGGAG -3'
(R):5'- TGTCACCAGCTACAGAGAGG -3'

Sequencing Primer
(F):5'- TACAACAAGGACCTGGAGTCTGC -3'
(R):5'- ATCCCTGACCCCTGCACATATG -3'
Posted On 2018-11-28