Incidental Mutation 'R6956:Mboat1'
ID 541473
Institutional Source Beutler Lab
Gene Symbol Mboat1
Ensembl Gene ENSMUSG00000038732
Gene Name membrane bound O-acyltransferase domain containing 1
Synonyms 9130215M02Rik, Oact1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 30136489-30246717 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30238076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 396 (V396A)
Ref Sequence ENSEMBL: ENSMUSP00000045441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047311]
AlphaFold Q8BH98
Predicted Effect possibly damaging
Transcript: ENSMUST00000047311
AA Change: V396A

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045441
Gene: ENSMUSG00000038732
AA Change: V396A

DomainStartEndE-ValueType
Pfam:MBOAT 36 438 4.8e-29 PFAM
transmembrane domain 455 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the membrane-bound O-acetyltransferase superfamily. The encoded transmembrane protein is an enzyme that transfers organic compounds, preferably from oleoyl-CoA, to hydroxyl groups of protein targets in membranes. A translocation disrupting this gene may be associated with brachydactyly syndactyly syndrome. Alternately spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Mboat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Mboat1 APN 13 30195793 splice site probably benign
IGL01331:Mboat1 APN 13 30219701 splice site probably benign
IGL01837:Mboat1 APN 13 30241183 missense possibly damaging 0.72
IGL02070:Mboat1 APN 13 30224397 missense probably benign 0.02
IGL03338:Mboat1 APN 13 30136759 missense probably benign 0.01
langsat UTSW 13 30202375 missense probably benign 0.37
R0201:Mboat1 UTSW 13 30202375 missense probably benign 0.37
R0322:Mboat1 UTSW 13 30232080 splice site probably benign
R0448:Mboat1 UTSW 13 30202410 missense probably damaging 1.00
R1793:Mboat1 UTSW 13 30219650 missense probably damaging 0.99
R2040:Mboat1 UTSW 13 30241317 critical splice donor site probably null
R3054:Mboat1 UTSW 13 30195741 missense probably benign
R3122:Mboat1 UTSW 13 30238048 missense probably damaging 1.00
R4948:Mboat1 UTSW 13 30241230 missense probably damaging 1.00
R4958:Mboat1 UTSW 13 30224393 missense probably damaging 1.00
R4992:Mboat1 UTSW 13 30202360 missense possibly damaging 0.80
R5429:Mboat1 UTSW 13 30219667 missense probably benign 0.02
R5862:Mboat1 UTSW 13 30235697 missense probably damaging 1.00
R6025:Mboat1 UTSW 13 30224526 missense probably benign
R6352:Mboat1 UTSW 13 30202420 missense possibly damaging 0.59
R7088:Mboat1 UTSW 13 30195789 critical splice donor site probably null
R7165:Mboat1 UTSW 13 30224415 missense probably damaging 1.00
R7366:Mboat1 UTSW 13 30202362 missense possibly damaging 0.94
R7727:Mboat1 UTSW 13 30226306 missense probably benign 0.00
R7938:Mboat1 UTSW 13 30231976 missense possibly damaging 0.53
R8239:Mboat1 UTSW 13 30245350 missense probably damaging 1.00
R8872:Mboat1 UTSW 13 30226414 missense probably damaging 1.00
R9248:Mboat1 UTSW 13 30226409 missense probably damaging 1.00
Z1177:Mboat1 UTSW 13 30226378 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGACTTCAGTGTGGTCTGC -3'
(R):5'- GAAGGAAGTTATCACTCGGCATC -3'

Sequencing Primer
(F):5'- TCAGTGTGGTCTGCCCGAAG -3'
(R):5'- GAAGTTATCACTCGGCATCAAAAAG -3'
Posted On 2018-11-28