Incidental Mutation 'R6956:Vcan'
ID 541474
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Name versican
Synonyms PG-M, hdf, heart defect, Cspg2, DPEAAE, 5430420N07Rik
MMRRC Submission 045067-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 89803431-89890628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89837550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2665 (I2665F)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109546
AA Change: I2665F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: I2665F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
AA Change: I1705F

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: I1705F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 G A 8: 111,781,762 (GRCm39) V945M probably benign Het
Amotl2 A G 9: 102,601,967 (GRCm39) T371A probably damaging Het
Bmpr1a A G 14: 34,163,132 (GRCm39) I86T possibly damaging Het
C9 A T 15: 6,474,945 (GRCm39) M35L probably benign Het
Cc2d1a G T 8: 84,862,528 (GRCm39) P661T probably damaging Het
Ccdc202 T A 14: 96,119,869 (GRCm39) W209R probably damaging Het
Dcdc2a T A 13: 25,303,349 (GRCm39) S293R probably benign Het
Dchs2 T A 3: 83,261,233 (GRCm39) N2500K probably benign Het
Dicer1 A G 12: 104,697,282 (GRCm39) S92P probably damaging Het
Dnah7a T A 1: 53,616,446 (GRCm39) I1172F probably benign Het
Dnajc6 A G 4: 101,471,470 (GRCm39) S364G probably damaging Het
Dpp6 A T 5: 27,803,819 (GRCm39) N255I probably damaging Het
Eif2ak4 T C 2: 118,252,748 (GRCm39) I440T probably damaging Het
Fam184b T C 5: 45,688,099 (GRCm39) T937A probably damaging Het
Fam229b T A 10: 39,009,843 (GRCm39) probably null Het
Gbp11 A G 5: 105,476,241 (GRCm39) probably null Het
Gipc2 A G 3: 151,799,885 (GRCm39) F282L probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
H2-T3 T A 17: 36,500,263 (GRCm39) Y144F probably damaging Het
Kel T G 6: 41,664,907 (GRCm39) D7A probably damaging Het
Lrrc7 A G 3: 157,994,668 (GRCm39) V166A probably benign Het
Mapt T C 11: 104,209,081 (GRCm39) probably null Het
Marchf3 A G 18: 56,909,053 (GRCm39) V244A probably benign Het
Mboat1 T C 13: 30,422,059 (GRCm39) V396A possibly damaging Het
Mphosph9 T C 5: 124,435,621 (GRCm39) D604G probably damaging Het
Muc16 T C 9: 18,556,322 (GRCm39) T3324A unknown Het
Nalf1 T A 8: 9,820,744 (GRCm39) Q92L probably benign Het
Nat10 T C 2: 103,564,757 (GRCm39) I495V probably benign Het
Or6c208 A T 10: 129,224,166 (GRCm39) K221N probably benign Het
Pfkfb2 T C 1: 130,635,337 (GRCm39) N75D probably damaging Het
Psmd3 T A 11: 98,586,377 (GRCm39) L515Q probably damaging Het
Rpgrip1l A C 8: 92,012,941 (GRCm39) probably null Het
Scube1 T C 15: 83,606,077 (GRCm39) Y65C probably damaging Het
Slc12a4 A G 8: 106,680,484 (GRCm39) F211L probably damaging Het
Socs7 T C 11: 97,267,849 (GRCm39) S327P probably benign Het
Spef2 A T 15: 9,685,021 (GRCm39) D591E probably damaging Het
Sult2a6 T A 7: 13,988,748 (GRCm39) D4V possibly damaging Het
Tdpoz8 T C 3: 92,981,279 (GRCm39) V25A possibly damaging Het
Tdrd9 A G 12: 112,002,788 (GRCm39) probably benign Het
Tgm4 G T 9: 122,893,768 (GRCm39) M155I possibly damaging Het
Togaram2 T C 17: 72,036,183 (GRCm39) V891A probably benign Het
Usp1 A G 4: 98,819,243 (GRCm39) E235G probably damaging Het
Usp2 T A 9: 44,004,053 (GRCm39) V533E probably damaging Het
Vmn2r31 G A 7: 7,397,505 (GRCm39) S251L probably benign Het
Vmn2r84 C A 10: 130,225,136 (GRCm39) C458F probably damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89,852,821 (GRCm39) missense probably damaging 1.00
IGL00502:Vcan APN 13 89,840,438 (GRCm39) missense probably benign
IGL00504:Vcan APN 13 89,839,394 (GRCm39) missense possibly damaging 0.70
IGL00566:Vcan APN 13 89,837,098 (GRCm39) missense probably benign 0.01
IGL00701:Vcan APN 13 89,851,845 (GRCm39) missense probably benign
IGL00743:Vcan APN 13 89,873,425 (GRCm39) missense probably damaging 0.98
IGL00962:Vcan APN 13 89,810,171 (GRCm39) missense probably damaging 1.00
IGL01085:Vcan APN 13 89,828,077 (GRCm39) missense probably damaging 1.00
IGL01317:Vcan APN 13 89,839,787 (GRCm39) missense probably benign 0.00
IGL01349:Vcan APN 13 89,852,062 (GRCm39) missense probably damaging 0.98
IGL01391:Vcan APN 13 89,852,288 (GRCm39) missense probably benign 0.19
IGL01644:Vcan APN 13 89,836,794 (GRCm39) missense probably benign 0.13
IGL01657:Vcan APN 13 89,838,705 (GRCm39) missense probably damaging 1.00
IGL01707:Vcan APN 13 89,837,864 (GRCm39) missense probably damaging 1.00
IGL01764:Vcan APN 13 89,873,507 (GRCm39) missense probably damaging 1.00
IGL01920:Vcan APN 13 89,837,324 (GRCm39) missense probably benign 0.04
IGL01989:Vcan APN 13 89,837,478 (GRCm39) missense possibly damaging 0.86
IGL01999:Vcan APN 13 89,832,557 (GRCm39) missense probably damaging 1.00
IGL02083:Vcan APN 13 89,873,684 (GRCm39) missense probably damaging 1.00
IGL02160:Vcan APN 13 89,832,612 (GRCm39) missense probably damaging 1.00
IGL02217:Vcan APN 13 89,851,196 (GRCm39) missense probably damaging 1.00
IGL02522:Vcan APN 13 89,852,968 (GRCm39) missense probably benign 0.00
IGL02527:Vcan APN 13 89,838,776 (GRCm39) missense possibly damaging 0.95
IGL02926:Vcan APN 13 89,836,742 (GRCm39) missense probably damaging 0.98
IGL03061:Vcan APN 13 89,851,394 (GRCm39) missense probably benign 0.25
IGL03331:Vcan APN 13 89,810,051 (GRCm39) missense probably damaging 1.00
IGL03352:Vcan APN 13 89,853,125 (GRCm39) missense probably benign 0.00
R0041:Vcan UTSW 13 89,810,104 (GRCm39) missense probably damaging 1.00
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0102:Vcan UTSW 13 89,851,787 (GRCm39) missense probably benign 0.01
R0109:Vcan UTSW 13 89,826,192 (GRCm39) critical splice donor site probably null
R0139:Vcan UTSW 13 89,839,380 (GRCm39) missense probably damaging 1.00
R0295:Vcan UTSW 13 89,860,310 (GRCm39) missense probably benign 0.06
R0375:Vcan UTSW 13 89,839,394 (GRCm39) missense probably damaging 0.99
R0379:Vcan UTSW 13 89,851,665 (GRCm39) missense probably damaging 0.99
R0457:Vcan UTSW 13 89,851,318 (GRCm39) missense possibly damaging 0.78
R0482:Vcan UTSW 13 89,826,264 (GRCm39) missense probably damaging 1.00
R0485:Vcan UTSW 13 89,852,779 (GRCm39) missense possibly damaging 0.92
R0532:Vcan UTSW 13 89,851,891 (GRCm39) missense probably damaging 0.99
R0561:Vcan UTSW 13 89,879,583 (GRCm39) missense possibly damaging 0.86
R0561:Vcan UTSW 13 89,860,372 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,860,386 (GRCm39) missense probably damaging 1.00
R0636:Vcan UTSW 13 89,852,825 (GRCm39) missense probably damaging 0.99
R0680:Vcan UTSW 13 89,827,941 (GRCm39) missense probably damaging 1.00
R0849:Vcan UTSW 13 89,853,072 (GRCm39) missense possibly damaging 0.75
R1006:Vcan UTSW 13 89,833,196 (GRCm39) critical splice donor site probably null
R1104:Vcan UTSW 13 89,840,529 (GRCm39) missense probably damaging 1.00
R1118:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1137:Vcan UTSW 13 89,852,422 (GRCm39) missense probably damaging 1.00
R1199:Vcan UTSW 13 89,827,913 (GRCm39) splice site probably null
R1219:Vcan UTSW 13 89,828,023 (GRCm39) missense probably damaging 1.00
R1296:Vcan UTSW 13 89,805,675 (GRCm39) missense probably damaging 1.00
R1332:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1336:Vcan UTSW 13 89,841,174 (GRCm39) missense probably damaging 1.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1403:Vcan UTSW 13 89,836,603 (GRCm39) missense probably benign 0.00
R1546:Vcan UTSW 13 89,841,075 (GRCm39) missense probably damaging 0.99
R1604:Vcan UTSW 13 89,837,780 (GRCm39) missense probably benign 0.42
R1616:Vcan UTSW 13 89,853,782 (GRCm39) missense probably damaging 1.00
R1636:Vcan UTSW 13 89,851,786 (GRCm39) missense possibly damaging 0.90
R1654:Vcan UTSW 13 89,810,065 (GRCm39) missense probably damaging 1.00
R1680:Vcan UTSW 13 89,851,666 (GRCm39) missense probably benign 0.19
R1694:Vcan UTSW 13 89,836,602 (GRCm39) missense probably damaging 0.98
R1712:Vcan UTSW 13 89,869,894 (GRCm39) missense probably damaging 1.00
R1754:Vcan UTSW 13 89,852,854 (GRCm39) missense probably benign 0.01
R1756:Vcan UTSW 13 89,839,800 (GRCm39) missense probably benign 0.05
R1824:Vcan UTSW 13 89,853,331 (GRCm39) missense possibly damaging 0.75
R1852:Vcan UTSW 13 89,853,511 (GRCm39) missense probably damaging 0.99
R1868:Vcan UTSW 13 89,838,990 (GRCm39) missense probably benign 0.12
R1920:Vcan UTSW 13 89,841,134 (GRCm39) missense probably damaging 1.00
R1932:Vcan UTSW 13 89,853,653 (GRCm39) missense possibly damaging 0.78
R1934:Vcan UTSW 13 89,851,045 (GRCm39) missense probably damaging 1.00
R1942:Vcan UTSW 13 89,851,543 (GRCm39) missense probably benign 0.01
R1964:Vcan UTSW 13 89,840,861 (GRCm39) missense probably benign 0.02
R1970:Vcan UTSW 13 89,837,157 (GRCm39) missense probably damaging 1.00
R2045:Vcan UTSW 13 89,839,104 (GRCm39) missense probably benign 0.00
R2110:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2111:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2112:Vcan UTSW 13 89,841,422 (GRCm39) missense probably damaging 1.00
R2136:Vcan UTSW 13 89,837,856 (GRCm39) missense probably damaging 1.00
R2158:Vcan UTSW 13 89,851,648 (GRCm39) missense possibly damaging 0.68
R2376:Vcan UTSW 13 89,851,529 (GRCm39) missense possibly damaging 0.80
R2385:Vcan UTSW 13 89,837,568 (GRCm39) missense probably damaging 1.00
R2443:Vcan UTSW 13 89,852,794 (GRCm39) missense probably damaging 1.00
R2876:Vcan UTSW 13 89,852,356 (GRCm39) missense probably damaging 1.00
R3607:Vcan UTSW 13 89,851,420 (GRCm39) missense probably damaging 0.98
R4042:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4043:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4044:Vcan UTSW 13 89,840,662 (GRCm39) missense probably benign 0.35
R4065:Vcan UTSW 13 89,828,006 (GRCm39) missense probably damaging 1.00
R4161:Vcan UTSW 13 89,833,277 (GRCm39) missense probably damaging 1.00
R4178:Vcan UTSW 13 89,873,666 (GRCm39) missense probably damaging 1.00
R4290:Vcan UTSW 13 89,873,605 (GRCm39) missense probably damaging 1.00
R4530:Vcan UTSW 13 89,852,147 (GRCm39) missense probably damaging 0.97
R4666:Vcan UTSW 13 89,828,053 (GRCm39) missense probably damaging 1.00
R4785:Vcan UTSW 13 89,853,908 (GRCm39) missense probably damaging 1.00
R4870:Vcan UTSW 13 89,852,858 (GRCm39) missense probably benign 0.01
R4973:Vcan UTSW 13 89,836,961 (GRCm39) missense probably benign 0.30
R5037:Vcan UTSW 13 89,852,096 (GRCm39) missense probably damaging 1.00
R5104:Vcan UTSW 13 89,805,591 (GRCm39) intron probably benign
R5124:Vcan UTSW 13 89,873,636 (GRCm39) missense probably damaging 1.00
R5129:Vcan UTSW 13 89,838,359 (GRCm39) missense probably damaging 1.00
R5198:Vcan UTSW 13 89,838,991 (GRCm39) missense probably damaging 1.00
R5240:Vcan UTSW 13 89,840,651 (GRCm39) missense probably benign 0.08
R5254:Vcan UTSW 13 89,839,719 (GRCm39) missense probably damaging 0.99
R5280:Vcan UTSW 13 89,838,405 (GRCm39) missense probably benign 0.00
R5522:Vcan UTSW 13 89,839,929 (GRCm39) missense possibly damaging 0.62
R5557:Vcan UTSW 13 89,851,231 (GRCm39) missense possibly damaging 0.77
R5568:Vcan UTSW 13 89,836,790 (GRCm39) missense probably damaging 1.00
R5578:Vcan UTSW 13 89,839,622 (GRCm39) missense probably benign 0.01
R5627:Vcan UTSW 13 89,839,254 (GRCm39) frame shift probably null
R5687:Vcan UTSW 13 89,826,253 (GRCm39) missense probably damaging 1.00
R5752:Vcan UTSW 13 89,828,069 (GRCm39) missense probably damaging 1.00
R5879:Vcan UTSW 13 89,852,071 (GRCm39) missense probably damaging 0.99
R5941:Vcan UTSW 13 89,840,810 (GRCm39) missense probably damaging 0.98
R6113:Vcan UTSW 13 89,805,655 (GRCm39) nonsense probably null
R6135:Vcan UTSW 13 89,838,045 (GRCm39) missense probably benign 0.36
R6252:Vcan UTSW 13 89,839,339 (GRCm39) nonsense probably null
R6280:Vcan UTSW 13 89,873,492 (GRCm39) missense probably damaging 1.00
R6317:Vcan UTSW 13 89,839,716 (GRCm39) missense probably benign 0.22
R6327:Vcan UTSW 13 89,852,951 (GRCm39) missense probably damaging 0.99
R6460:Vcan UTSW 13 89,838,806 (GRCm39) missense possibly damaging 0.61
R6669:Vcan UTSW 13 89,852,850 (GRCm39) missense probably benign 0.21
R6744:Vcan UTSW 13 89,853,301 (GRCm39) missense probably damaging 1.00
R6819:Vcan UTSW 13 89,853,244 (GRCm39) missense probably benign 0.00
R6880:Vcan UTSW 13 89,860,500 (GRCm39) missense probably damaging 1.00
R6971:Vcan UTSW 13 89,826,252 (GRCm39) missense probably damaging 1.00
R6985:Vcan UTSW 13 89,828,075 (GRCm39) missense probably damaging 1.00
R6994:Vcan UTSW 13 89,841,526 (GRCm39) missense possibly damaging 0.94
R6997:Vcan UTSW 13 89,838,737 (GRCm39) missense probably damaging 0.98
R7029:Vcan UTSW 13 89,838,360 (GRCm39) missense probably damaging 1.00
R7066:Vcan UTSW 13 89,853,805 (GRCm39) missense probably damaging 1.00
R7156:Vcan UTSW 13 89,837,229 (GRCm39) missense possibly damaging 0.95
R7171:Vcan UTSW 13 89,873,710 (GRCm39) missense probably damaging 1.00
R7176:Vcan UTSW 13 89,837,055 (GRCm39) missense probably benign 0.01
R7229:Vcan UTSW 13 89,853,389 (GRCm39) missense possibly damaging 0.87
R7250:Vcan UTSW 13 89,879,576 (GRCm39) critical splice donor site probably null
R7250:Vcan UTSW 13 89,869,805 (GRCm39) missense probably damaging 1.00
R7262:Vcan UTSW 13 89,853,280 (GRCm39) missense possibly damaging 0.62
R7289:Vcan UTSW 13 89,840,852 (GRCm39) nonsense probably null
R7299:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7301:Vcan UTSW 13 89,853,385 (GRCm39) missense probably benign
R7425:Vcan UTSW 13 89,837,951 (GRCm39) missense probably damaging 0.99
R7514:Vcan UTSW 13 89,852,237 (GRCm39) missense probably damaging 0.97
R7579:Vcan UTSW 13 89,840,577 (GRCm39) missense probably damaging 1.00
R7618:Vcan UTSW 13 89,840,342 (GRCm39) missense probably damaging 0.99
R7655:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7656:Vcan UTSW 13 89,833,233 (GRCm39) missense probably damaging 1.00
R7676:Vcan UTSW 13 89,839,908 (GRCm39) missense probably damaging 1.00
R7719:Vcan UTSW 13 89,852,738 (GRCm39) missense probably damaging 0.98
R7753:Vcan UTSW 13 89,837,442 (GRCm39) missense probably damaging 1.00
R7762:Vcan UTSW 13 89,841,056 (GRCm39) missense probably damaging 1.00
R7778:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7824:Vcan UTSW 13 89,836,773 (GRCm39) missense probably damaging 1.00
R7995:Vcan UTSW 13 89,839,977 (GRCm39) missense probably benign
R7998:Vcan UTSW 13 89,852,446 (GRCm39) missense probably damaging 1.00
R8033:Vcan UTSW 13 89,852,479 (GRCm39) missense probably benign 0.04
R8061:Vcan UTSW 13 89,805,409 (GRCm39) missense probably benign 0.45
R8103:Vcan UTSW 13 89,851,439 (GRCm39) nonsense probably null
R8103:Vcan UTSW 13 89,805,777 (GRCm39) missense probably damaging 1.00
R8124:Vcan UTSW 13 89,852,373 (GRCm39) missense possibly damaging 0.93
R8162:Vcan UTSW 13 89,853,106 (GRCm39) nonsense probably null
R8166:Vcan UTSW 13 89,840,855 (GRCm39) missense probably benign 0.02
R8274:Vcan UTSW 13 89,853,089 (GRCm39) missense probably benign 0.02
R8284:Vcan UTSW 13 89,852,454 (GRCm39) missense possibly damaging 0.68
R8417:Vcan UTSW 13 89,836,862 (GRCm39) missense probably benign 0.19
R8696:Vcan UTSW 13 89,839,217 (GRCm39) missense probably benign 0.00
R8738:Vcan UTSW 13 89,840,439 (GRCm39) missense probably benign 0.17
R8792:Vcan UTSW 13 89,840,230 (GRCm39) missense possibly damaging 0.91
R8887:Vcan UTSW 13 89,853,026 (GRCm39) missense probably benign
R9049:Vcan UTSW 13 89,826,224 (GRCm39) missense probably damaging 1.00
R9074:Vcan UTSW 13 89,839,146 (GRCm39) missense possibly damaging 0.95
R9095:Vcan UTSW 13 89,852,644 (GRCm39) missense probably benign 0.32
R9172:Vcan UTSW 13 89,828,050 (GRCm39) missense probably damaging 1.00
R9199:Vcan UTSW 13 89,838,615 (GRCm39) nonsense probably null
R9259:Vcan UTSW 13 89,838,989 (GRCm39) missense probably damaging 0.99
R9455:Vcan UTSW 13 89,837,452 (GRCm39) missense probably damaging 1.00
R9476:Vcan UTSW 13 89,851,531 (GRCm39) missense possibly damaging 0.95
R9477:Vcan UTSW 13 89,841,128 (GRCm39) missense probably damaging 1.00
R9555:Vcan UTSW 13 89,839,659 (GRCm39) missense
R9579:Vcan UTSW 13 89,837,713 (GRCm39) missense possibly damaging 0.67
R9606:Vcan UTSW 13 89,853,491 (GRCm39) missense probably damaging 1.00
R9645:Vcan UTSW 13 89,841,081 (GRCm39) missense probably benign 0.00
R9659:Vcan UTSW 13 89,839,860 (GRCm39) missense probably damaging 0.99
R9766:Vcan UTSW 13 89,839,247 (GRCm39) missense probably benign 0.00
R9778:Vcan UTSW 13 89,837,930 (GRCm39) missense probably damaging 1.00
X0058:Vcan UTSW 13 89,840,612 (GRCm39) missense probably benign 0.21
X0065:Vcan UTSW 13 89,853,868 (GRCm39) missense probably damaging 0.96
Z1176:Vcan UTSW 13 89,840,690 (GRCm39) missense probably benign 0.10
Z1177:Vcan UTSW 13 89,852,192 (GRCm39) missense probably damaging 1.00
Z1177:Vcan UTSW 13 89,851,907 (GRCm39) nonsense probably null
Z1177:Vcan UTSW 13 89,851,643 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTGAAATGAAGGACCTCC -3'
(R):5'- CCAACTGAGGAATCATTTGAAGG -3'

Sequencing Primer
(F):5'- GCTGAAATGAAGGACCTCCATATTTC -3'
(R):5'- ACTGAGGAATCATTTGAAGGCTCTG -3'
Posted On 2018-11-28