Incidental Mutation 'R6956:Bmpr1a'
ID 541475
Institutional Source Beutler Lab
Gene Symbol Bmpr1a
Ensembl Gene ENSMUSG00000021796
Gene Name bone morphogenetic protein receptor, type 1A
Synonyms BMPR-IA, 1110037I22Rik, Bmpr, ALK3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 34410734-34503341 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34441175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 86 (I86T)
Ref Sequence ENSEMBL: ENSMUSP00000126852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049005] [ENSMUST00000165280] [ENSMUST00000171343] [ENSMUST00000171551]
AlphaFold P36895
Predicted Effect possibly damaging
Transcript: ENSMUST00000049005
AA Change: I86T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035900
Gene: ENSMUSG00000021796
AA Change: I86T

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 4.6e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165280
AA Change: I86T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131984
Gene: ENSMUSG00000021796
AA Change: I86T

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 1.3e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171343
AA Change: I86T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126852
Gene: ENSMUSG00000021796
AA Change: I86T

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171551
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 9.5, are smaller than normal, and form no mesoderm; a conditional knockout resulted in gross malformations of the limbs with complete agenesis of the hindlimb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in Bmpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Bmpr1a APN 14 34434419 missense probably benign
IGL03100:Bmpr1a APN 14 34441207 unclassified probably benign
R0329:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0330:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0411:Bmpr1a UTSW 14 34415877 missense possibly damaging 0.58
R0537:Bmpr1a UTSW 14 34443812 unclassified probably benign
R1707:Bmpr1a UTSW 14 34425141 splice site probably benign
R1767:Bmpr1a UTSW 14 34447770 critical splice donor site probably null
R1992:Bmpr1a UTSW 14 34425093 missense probably damaging 1.00
R3757:Bmpr1a UTSW 14 34434667 nonsense probably null
R4125:Bmpr1a UTSW 14 34434733 missense probably benign 0.35
R5320:Bmpr1a UTSW 14 34425042 missense probably damaging 1.00
R7254:Bmpr1a UTSW 14 34414763 missense probably benign 0.03
R7267:Bmpr1a UTSW 14 34443879 missense possibly damaging 0.47
R7270:Bmpr1a UTSW 14 34441125 missense probably damaging 0.96
R8166:Bmpr1a UTSW 14 34425069 missense probably damaging 1.00
R8348:Bmpr1a UTSW 14 34414802 missense probably benign 0.24
R8448:Bmpr1a UTSW 14 34414802 missense probably benign 0.24
R8948:Bmpr1a UTSW 14 34441191 missense possibly damaging 0.69
R8950:Bmpr1a UTSW 14 34441191 missense possibly damaging 0.69
R9246:Bmpr1a UTSW 14 34434707 missense probably benign 0.00
R9362:Bmpr1a UTSW 14 34434403 missense probably benign 0.01
R9647:Bmpr1a UTSW 14 34414737 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCTCAACTCTGCTCACAG -3'
(R):5'- TCCAGTGCCTTCAACCACTAAG -3'

Sequencing Primer
(F):5'- ACTCACAGGCTGATTTCTGTACAGG -3'
(R):5'- GTGCCTTCAACCACTAAGCTATGG -3'
Posted On 2018-11-28