Incidental Mutation 'R6956:4921530L21Rik'
ID 541476
Institutional Source Beutler Lab
Gene Symbol 4921530L21Rik
Ensembl Gene ENSMUSG00000034689
Gene Name RIKEN cDNA 4921530L21 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R6956 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 95881254-95882780 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 95882433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 209 (W209R)
Ref Sequence ENSEMBL: ENSMUSP00000153934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045892] [ENSMUST00000228913]
AlphaFold Q9CQ47
Predicted Effect probably damaging
Transcript: ENSMUST00000045892
AA Change: W209R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044028
Gene: ENSMUSG00000034689
AA Change: W209R

DomainStartEndE-ValueType
coiled coil region 36 62 N/A INTRINSIC
coiled coil region 127 175 N/A INTRINSIC
coiled coil region 200 245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228913
AA Change: W209R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
C9 A T 15: 6,445,464 M35L probably benign Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in 4921530L21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0356:4921530L21Rik UTSW 14 95882365 missense possibly damaging 0.92
R0633:4921530L21Rik UTSW 14 95881943 missense probably damaging 1.00
R1396:4921530L21Rik UTSW 14 95882551 missense probably benign 0.01
R5561:4921530L21Rik UTSW 14 95882371 missense probably benign 0.26
R7431:4921530L21Rik UTSW 14 95881837 missense probably benign 0.15
R7436:4921530L21Rik UTSW 14 95882591 missense probably benign
R7689:4921530L21Rik UTSW 14 95881816 missense probably benign
R7720:4921530L21Rik UTSW 14 95882112 missense probably benign 0.04
R7724:4921530L21Rik UTSW 14 95882250 missense possibly damaging 0.95
R7821:4921530L21Rik UTSW 14 95882050 missense possibly damaging 0.91
R8370:4921530L21Rik UTSW 14 95882494 missense probably damaging 1.00
Z1177:4921530L21Rik UTSW 14 95882130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAAGCCTTCCAGAATGAGGC -3'
(R):5'- GTGGTTACATTCTTGGGCCAC -3'

Sequencing Primer
(F):5'- CCTTCCAGAATGAGGCTAAGGC -3'
(R):5'- GGGCCACACTTCTTTGGGTC -3'
Posted On 2018-11-28