Incidental Mutation 'R6956:C9'
ID541477
Institutional Source Beutler Lab
Gene Symbol C9
Ensembl Gene ENSMUSG00000022149
Gene Namecomplement component 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6956 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location6445327-6498751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6445464 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 35 (M35L)
Ref Sequence ENSEMBL: ENSMUSP00000022749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022749] [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110664]
Predicted Effect probably benign
Transcript: ENSMUST00000022749
AA Change: M35L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022749
Gene: ENSMUSG00000022149
AA Change: M35L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
TSP1 56 106 1.8e-6 SMART
LDLa 111 147 2.7e-12 SMART
MACPF 304 519 2.9e-52 SMART
Blast:EGF 525 556 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000078019
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080880
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110664
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik T A 14: 95,882,433 W209R probably damaging Het
Aars G A 8: 111,055,130 V945M probably benign Het
Amotl2 A G 9: 102,724,768 T371A probably damaging Het
Bmpr1a A G 14: 34,441,175 I86T possibly damaging Het
Cc2d1a G T 8: 84,135,899 P661T probably damaging Het
Dcdc2a T A 13: 25,119,366 S293R probably benign Het
Dchs2 T A 3: 83,353,926 N2500K probably benign Het
Dicer1 A G 12: 104,731,023 S92P probably damaging Het
Dnah7a T A 1: 53,577,287 I1172F probably benign Het
Dnajc6 A G 4: 101,614,273 S364G probably damaging Het
Dpp6 A T 5: 27,598,821 N255I probably damaging Het
Eif2ak4 T C 2: 118,422,267 I440T probably damaging Het
Fam155a T A 8: 9,770,744 Q92L probably benign Het
Fam184b T C 5: 45,530,757 T937A probably damaging Het
Fam229b T A 10: 39,133,847 probably null Het
Gbp11 A G 5: 105,328,375 probably null Het
Gipc2 A G 3: 152,094,248 F282L probably benign Het
Gm4858 T C 3: 93,073,972 V25A possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
H2-T3 T A 17: 36,189,371 Y144F probably damaging Het
Kel T G 6: 41,687,973 D7A probably damaging Het
Lrrc7 A G 3: 158,289,031 V166A probably benign Het
Mapt T C 11: 104,318,255 probably null Het
March3 A G 18: 56,775,981 V244A probably benign Het
Mboat1 T C 13: 30,238,076 V396A possibly damaging Het
Mphosph9 T C 5: 124,297,558 D604G probably damaging Het
Muc16 T C 9: 18,645,026 T3324A unknown Het
Nat10 T C 2: 103,734,412 I495V probably benign Het
Olfr784 A T 10: 129,388,297 K221N probably benign Het
Pfkfb2 T C 1: 130,707,600 N75D probably damaging Het
Psmd3 T A 11: 98,695,551 L515Q probably damaging Het
Rpgrip1l A C 8: 91,286,313 probably null Het
Scube1 T C 15: 83,721,876 Y65C probably damaging Het
Slc12a4 A G 8: 105,953,852 F211L probably damaging Het
Socs7 T C 11: 97,377,023 S327P probably benign Het
Spef2 A T 15: 9,684,935 D591E probably damaging Het
Sult2a6 T A 7: 14,254,823 D4V possibly damaging Het
Tdrd9 A G 12: 112,036,354 probably benign Het
Tgm4 G T 9: 123,064,703 M155I possibly damaging Het
Togaram2 T C 17: 71,729,188 V891A probably benign Het
Usp1 A G 4: 98,931,006 E235G probably damaging Het
Usp2 T A 9: 44,092,756 V533E probably damaging Het
Vcan T A 13: 89,689,431 I2665F probably damaging Het
Vmn2r31 G A 7: 7,394,506 S251L probably benign Het
Vmn2r84 C A 10: 130,389,267 C458F probably damaging Het
Other mutations in C9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:C9 APN 15 6486656 missense probably benign 0.04
IGL00229:C9 APN 15 6483231 missense possibly damaging 0.68
IGL00647:C9 APN 15 6483083 missense probably benign 0.43
IGL01618:C9 APN 15 6459668 missense probably benign 0.38
IGL02530:C9 APN 15 6497132 missense probably benign
R0267:C9 UTSW 15 6467458 missense probably benign 0.00
R0477:C9 UTSW 15 6458183 missense probably benign 0.25
R0552:C9 UTSW 15 6445437 missense probably damaging 0.98
R0701:C9 UTSW 15 6467421 missense probably damaging 1.00
R0792:C9 UTSW 15 6486762 missense probably damaging 1.00
R0881:C9 UTSW 15 6458868 splice site probably benign
R1281:C9 UTSW 15 6489840 missense possibly damaging 0.80
R1384:C9 UTSW 15 6458934 missense probably benign 0.08
R1522:C9 UTSW 15 6486762 missense probably damaging 1.00
R1988:C9 UTSW 15 6483138 frame shift probably null
R2229:C9 UTSW 15 6445420 missense possibly damaging 0.95
R2406:C9 UTSW 15 6483299 missense possibly damaging 0.76
R3720:C9 UTSW 15 6483119 missense possibly damaging 0.95
R3723:C9 UTSW 15 6483080 missense possibly damaging 0.77
R3929:C9 UTSW 15 6467458 missense probably benign 0.00
R4371:C9 UTSW 15 6491484 missense probably damaging 1.00
R4615:C9 UTSW 15 6491463 missense probably damaging 0.99
R4616:C9 UTSW 15 6491463 missense probably damaging 0.99
R4618:C9 UTSW 15 6491463 missense probably damaging 0.99
R4749:C9 UTSW 15 6489830 missense probably benign 0.19
R4764:C9 UTSW 15 6459643 missense probably damaging 1.00
R5544:C9 UTSW 15 6497027 missense probably damaging 0.99
R5723:C9 UTSW 15 6486816 missense probably damaging 1.00
R5813:C9 UTSW 15 6497126 missense probably benign 0.05
R6735:C9 UTSW 15 6489906 missense probably benign 0.06
R6754:C9 UTSW 15 6489943 nonsense probably null
R7706:C9 UTSW 15 6458921 missense probably benign 0.08
R7791:C9 UTSW 15 6489878 missense possibly damaging 0.82
R7893:C9 UTSW 15 6483245 missense possibly damaging 0.94
R7976:C9 UTSW 15 6483245 missense possibly damaging 0.94
Z1177:C9 UTSW 15 6491519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACACTTAGCCTAAGCCAAC -3'
(R):5'- TCAGAAACTGGAGACAACCG -3'

Sequencing Primer
(F):5'- TTAGCCTAAGCCAACACCTATG -3'
(R):5'- AACTGGAGACAACCGTTTCTTTTTC -3'
Posted On2018-11-28