Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Spef2'

541478

Institutional Source

Beutler Lab

Gene Symbol

Spef2

Ensembl Gene

ENSMUSG00000072663

Gene Name

sperm flagellar 2

Synonyms

C230086A09Rik

MMRRC Submission

045067-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9578279-9748954 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9685021 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 591 (D591E)

Ref Sequence

ENSEMBL: ENSMUSP00000124891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000160236] [ENSMUST00000208854]

AlphaFold

Q8C9J3

Predicted Effect

probably damaging
Transcript: ENSMUST00000041840
AA Change: D534E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: D534E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	161	2.8e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	829	5.9e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000159093
AA Change: D591E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: D591E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	166	3.5e-57	PFAM
coiled coil region	167	205	N/A	INTRINSIC
low complexity region	208	220	N/A	INTRINSIC
coiled coil region	228	260	N/A	INTRINSIC
low complexity region	304	313	N/A	INTRINSIC
coiled coil region	369	402	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160236
AA Change: D534E

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: D534E

Domain	Start	End	E-Value	Type
Pfam:DUF1042	5	160	4.6e-59	PFAM
coiled coil region	171	203	N/A	INTRINSIC
low complexity region	247	256	N/A	INTRINSIC
coiled coil region	312	345	N/A	INTRINSIC
Pfam:ADK	600	787	3.7e-10	PFAM
low complexity region	819	855	N/A	INTRINSIC
low complexity region	899	907	N/A	INTRINSIC
low complexity region	1201	1225	N/A	INTRINSIC
low complexity region	1254	1268	N/A	INTRINSIC
low complexity region	1349	1359	N/A	INTRINSIC
SCOP:d1rec__	1368	1520	3e-3	SMART
low complexity region	1595	1614	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208854
AA Change: D534E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars1	G	A	8: 111,781,762 (GRCm39)	V945M	probably benign	Het
Amotl2	A	G	9: 102,601,967 (GRCm39)	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,163,132 (GRCm39)	I86T	possibly damaging	Het
C9	A	T	15: 6,474,945 (GRCm39)	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,862,528 (GRCm39)	P661T	probably damaging	Het
Ccdc202	T	A	14: 96,119,869 (GRCm39)	W209R	probably damaging	Het
Dcdc2a	T	A	13: 25,303,349 (GRCm39)	S293R	probably benign	Het
Dchs2	T	A	3: 83,261,233 (GRCm39)	N2500K	probably benign	Het
Dicer1	A	G	12: 104,697,282 (GRCm39)	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,616,446 (GRCm39)	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,471,470 (GRCm39)	S364G	probably damaging	Het
Dpp6	A	T	5: 27,803,819 (GRCm39)	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,252,748 (GRCm39)	I440T	probably damaging	Het
Fam184b	T	C	5: 45,688,099 (GRCm39)	T937A	probably damaging	Het
Fam229b	T	A	10: 39,009,843 (GRCm39)		probably null	Het
Gbp11	A	G	5: 105,476,241 (GRCm39)		probably null	Het
Gipc2	A	G	3: 151,799,885 (GRCm39)	F282L	probably benign	Het
Gpt2	G	A	8: 86,244,681 (GRCm39)	E325K	probably benign	Het
H2-T3	T	A	17: 36,500,263 (GRCm39)	Y144F	probably damaging	Het
Kel	T	G	6: 41,664,907 (GRCm39)	D7A	probably damaging	Het
Lrrc7	A	G	3: 157,994,668 (GRCm39)	V166A	probably benign	Het
Mapt	T	C	11: 104,209,081 (GRCm39)		probably null	Het
Marchf3	A	G	18: 56,909,053 (GRCm39)	V244A	probably benign	Het
Mboat1	T	C	13: 30,422,059 (GRCm39)	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,435,621 (GRCm39)	D604G	probably damaging	Het
Muc16	T	C	9: 18,556,322 (GRCm39)	T3324A	unknown	Het
Nalf1	T	A	8: 9,820,744 (GRCm39)	Q92L	probably benign	Het
Nat10	T	C	2: 103,564,757 (GRCm39)	I495V	probably benign	Het
Or6c208	A	T	10: 129,224,166 (GRCm39)	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,635,337 (GRCm39)	N75D	probably damaging	Het
Psmd3	T	A	11: 98,586,377 (GRCm39)	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 92,012,941 (GRCm39)		probably null	Het
Scube1	T	C	15: 83,606,077 (GRCm39)	Y65C	probably damaging	Het
Slc12a4	A	G	8: 106,680,484 (GRCm39)	F211L	probably damaging	Het
Socs7	T	C	11: 97,267,849 (GRCm39)	S327P	probably benign	Het
Sult2a6	T	A	7: 13,988,748 (GRCm39)	D4V	possibly damaging	Het
Tdpoz8	T	C	3: 92,981,279 (GRCm39)	V25A	possibly damaging	Het
Tdrd9	A	G	12: 112,002,788 (GRCm39)		probably benign	Het
Tgm4	G	T	9: 122,893,768 (GRCm39)	M155I	possibly damaging	Het
Togaram2	T	C	17: 72,036,183 (GRCm39)	V891A	probably benign	Het
Usp1	A	G	4: 98,819,243 (GRCm39)	E235G	probably damaging	Het
Usp2	T	A	9: 44,004,053 (GRCm39)	V533E	probably damaging	Het
Vcan	T	A	13: 89,837,550 (GRCm39)	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,397,505 (GRCm39)	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,225,136 (GRCm39)	C458F	probably damaging	Het

Other mutations in Spef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Spef2	APN	15	9,740,621 (GRCm39)	missense	probably damaging	1.00
IGL00886:Spef2	APN	15	9,663,181 (GRCm39)	missense	probably damaging	1.00
IGL01409:Spef2	APN	15	9,716,499 (GRCm39)	missense	probably damaging	1.00
IGL01413:Spef2	APN	15	9,676,376 (GRCm39)	missense	probably benign	0.16
IGL01474:Spef2	APN	15	9,663,244 (GRCm39)	missense	probably benign	0.00
IGL01603:Spef2	APN	15	9,704,466 (GRCm39)	missense	probably damaging	0.99
IGL02320:Spef2	APN	15	9,717,662 (GRCm39)	missense	probably damaging	0.99
IGL02570:Spef2	APN	15	9,717,584 (GRCm39)	nonsense	probably null
IGL02605:Spef2	APN	15	9,725,238 (GRCm39)	missense	probably damaging	0.99
IGL02890:Spef2	APN	15	9,748,853 (GRCm39)	start codon destroyed	probably null	1.00
IGL02904:Spef2	APN	15	9,679,432 (GRCm39)	missense	probably damaging	1.00
IGL02942:Spef2	APN	15	9,668,960 (GRCm39)	missense	possibly damaging	0.71
IGL02953:Spef2	APN	15	9,713,329 (GRCm39)	missense	possibly damaging	0.82
IGL02965:Spef2	APN	15	9,725,192 (GRCm39)	splice site	probably benign
IGL03263:Spef2	APN	15	9,667,305 (GRCm39)	missense	possibly damaging	0.72
IGL03302:Spef2	APN	15	9,676,466 (GRCm39)	missense	probably benign	0.01
R0101:Spef2	UTSW	15	9,713,194 (GRCm39)	missense	probably damaging	1.00
R0101:Spef2	UTSW	15	9,713,194 (GRCm39)	missense	probably damaging	1.00
R0183:Spef2	UTSW	15	9,716,445 (GRCm39)	missense	possibly damaging	0.70
R0386:Spef2	UTSW	15	9,584,148 (GRCm39)	missense	probably damaging	1.00
R0511:Spef2	UTSW	15	9,584,070 (GRCm39)	critical splice donor site	probably null
R0617:Spef2	UTSW	15	9,592,844 (GRCm39)	missense	probably damaging	1.00
R0655:Spef2	UTSW	15	9,626,217 (GRCm39)	missense	possibly damaging	0.96
R0829:Spef2	UTSW	15	9,687,899 (GRCm39)	missense	probably benign	0.10
R0908:Spef2	UTSW	15	9,614,281 (GRCm39)	splice site	probably null
R0939:Spef2	UTSW	15	9,704,636 (GRCm39)	splice site	probably null
R0973:Spef2	UTSW	15	9,716,482 (GRCm39)	missense	probably damaging	1.00
R1371:Spef2	UTSW	15	9,725,194 (GRCm39)	splice site	probably benign
R1392:Spef2	UTSW	15	9,647,349 (GRCm39)	missense	probably benign	0.15
R1392:Spef2	UTSW	15	9,647,349 (GRCm39)	missense	probably benign	0.15
R1428:Spef2	UTSW	15	9,596,793 (GRCm39)	unclassified	probably benign
R1518:Spef2	UTSW	15	9,667,316 (GRCm39)	missense	probably damaging	1.00
R1585:Spef2	UTSW	15	9,596,660 (GRCm39)	missense	probably damaging	1.00
R1654:Spef2	UTSW	15	9,634,738 (GRCm39)	missense	probably damaging	0.99
R1723:Spef2	UTSW	15	9,614,295 (GRCm39)	missense	probably damaging	1.00
R1757:Spef2	UTSW	15	9,717,568 (GRCm39)	missense	probably damaging	1.00
R1812:Spef2	UTSW	15	9,679,435 (GRCm39)	missense	probably damaging	1.00
R1817:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1818:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1873:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1875:Spef2	UTSW	15	9,597,487 (GRCm39)	missense	possibly damaging	0.78
R1875:Spef2	UTSW	15	9,584,194 (GRCm39)	missense	probably damaging	0.96
R1897:Spef2	UTSW	15	9,729,740 (GRCm39)	nonsense	probably null
R1901:Spef2	UTSW	15	9,607,463 (GRCm39)	missense	probably damaging	1.00
R1902:Spef2	UTSW	15	9,607,463 (GRCm39)	missense	probably damaging	1.00
R1943:Spef2	UTSW	15	9,663,280 (GRCm39)	missense	possibly damaging	0.76
R1968:Spef2	UTSW	15	9,609,602 (GRCm39)	missense	probably damaging	1.00
R1973:Spef2	UTSW	15	9,663,152 (GRCm39)	makesense	probably null
R1998:Spef2	UTSW	15	9,668,989 (GRCm39)	critical splice acceptor site	probably null
R1999:Spef2	UTSW	15	9,668,989 (GRCm39)	critical splice acceptor site	probably null
R2008:Spef2	UTSW	15	9,713,271 (GRCm39)	missense	possibly damaging	0.95
R2111:Spef2	UTSW	15	9,589,659 (GRCm39)	missense	probably damaging	1.00
R2127:Spef2	UTSW	15	9,729,747 (GRCm39)	missense	possibly damaging	0.53
R2405:Spef2	UTSW	15	9,626,120 (GRCm39)	nonsense	probably null
R2517:Spef2	UTSW	15	9,725,283 (GRCm39)	missense	possibly damaging	0.93
R2889:Spef2	UTSW	15	9,630,699 (GRCm39)	missense	probably damaging	0.99
R2988:Spef2	UTSW	15	9,682,709 (GRCm39)	missense	probably benign	0.43
R3792:Spef2	UTSW	15	9,704,622 (GRCm39)	missense	probably damaging	1.00
R4154:Spef2	UTSW	15	9,626,107 (GRCm39)	missense	probably benign	0.13
R4159:Spef2	UTSW	15	9,676,407 (GRCm39)	missense	probably damaging	1.00
R4199:Spef2	UTSW	15	9,667,366 (GRCm39)	missense	probably damaging	1.00
R4320:Spef2	UTSW	15	9,679,429 (GRCm39)	missense	possibly damaging	0.93
R4321:Spef2	UTSW	15	9,679,429 (GRCm39)	missense	possibly damaging	0.93
R4568:Spef2	UTSW	15	9,647,303 (GRCm39)	missense	probably damaging	1.00
R4625:Spef2	UTSW	15	9,647,524 (GRCm39)	missense	probably damaging	1.00
R4669:Spef2	UTSW	15	9,676,459 (GRCm39)	missense	probably benign	0.42
R4684:Spef2	UTSW	15	9,647,576 (GRCm39)	missense	probably benign	0.44
R4761:Spef2	UTSW	15	9,653,040 (GRCm39)	missense	probably damaging	1.00
R4839:Spef2	UTSW	15	9,713,264 (GRCm39)	nonsense	probably null
R5004:Spef2	UTSW	15	9,578,413 (GRCm39)	missense	probably benign	0.02
R5157:Spef2	UTSW	15	9,668,877 (GRCm39)	nonsense	probably null
R5230:Spef2	UTSW	15	9,667,316 (GRCm39)	missense	possibly damaging	0.62
R5315:Spef2	UTSW	15	9,596,777 (GRCm39)	missense	probably damaging	0.98
R5400:Spef2	UTSW	15	9,614,367 (GRCm39)	missense	probably damaging	1.00
R5591:Spef2	UTSW	15	9,583,922 (GRCm39)	missense	probably benign	0.02
R5599:Spef2	UTSW	15	9,729,789 (GRCm39)	missense	possibly damaging	0.53
R5605:Spef2	UTSW	15	9,609,606 (GRCm39)	missense	probably damaging	0.96
R5787:Spef2	UTSW	15	9,748,812 (GRCm39)	missense	possibly damaging	0.91
R5939:Spef2	UTSW	15	9,614,301 (GRCm39)	missense	probably benign	0.16
R6177:Spef2	UTSW	15	9,727,618 (GRCm39)	missense	possibly damaging	0.89
R6641:Spef2	UTSW	15	9,626,059 (GRCm39)	missense	probably damaging	1.00
R6665:Spef2	UTSW	15	9,600,604 (GRCm39)	critical splice donor site	probably null
R6944:Spef2	UTSW	15	9,592,835 (GRCm39)	missense	probably damaging	1.00
R6968:Spef2	UTSW	15	9,597,426 (GRCm39)	missense	probably benign	0.02
R7089:Spef2	UTSW	15	9,725,257 (GRCm39)	missense	probably damaging	1.00
R7117:Spef2	UTSW	15	9,729,924 (GRCm39)	missense	probably damaging	1.00
R7161:Spef2	UTSW	15	9,717,689 (GRCm39)	missense	probably benign	0.29
R7223:Spef2	UTSW	15	9,601,726 (GRCm39)	missense	unknown
R7263:Spef2	UTSW	15	9,653,098 (GRCm39)	splice site	probably null
R7270:Spef2	UTSW	15	9,600,066 (GRCm39)	critical splice donor site	probably null
R7303:Spef2	UTSW	15	9,647,576 (GRCm39)	missense	possibly damaging	0.92
R7369:Spef2	UTSW	15	9,584,293 (GRCm39)	missense	probably benign	0.02
R7464:Spef2	UTSW	15	9,740,671 (GRCm39)	missense	probably benign	0.23
R7498:Spef2	UTSW	15	9,727,625 (GRCm39)	missense	probably benign
R7587:Spef2	UTSW	15	9,713,305 (GRCm39)	missense	probably damaging	1.00
R7748:Spef2	UTSW	15	9,653,031 (GRCm39)	missense	probably damaging	0.98
R7772:Spef2	UTSW	15	9,704,567 (GRCm39)	missense	probably damaging	0.99
R7838:Spef2	UTSW	15	9,609,637 (GRCm39)	missense	possibly damaging	0.53
R7854:Spef2	UTSW	15	9,596,730 (GRCm39)	missense	possibly damaging	0.77
R7855:Spef2	UTSW	15	9,687,981 (GRCm39)	missense	possibly damaging	0.53
R7889:Spef2	UTSW	15	9,717,649 (GRCm39)	missense	probably damaging	1.00
R7943:Spef2	UTSW	15	9,601,171 (GRCm39)	missense	unknown
R8105:Spef2	UTSW	15	9,682,748 (GRCm39)	missense	probably benign	0.06
R8151:Spef2	UTSW	15	9,601,598 (GRCm39)	missense	unknown
R8296:Spef2	UTSW	15	9,727,629 (GRCm39)	missense	probably benign	0.06
R8393:Spef2	UTSW	15	9,676,615 (GRCm39)	missense	probably benign	0.27
R8405:Spef2	UTSW	15	9,612,643 (GRCm39)	missense	probably benign	0.00
R8552:Spef2	UTSW	15	9,600,765 (GRCm39)	intron	probably benign
R8691:Spef2	UTSW	15	9,602,005 (GRCm39)	nonsense	probably null
R8751:Spef2	UTSW	15	9,729,723 (GRCm39)	nonsense	probably null
R8847:Spef2	UTSW	15	9,668,913 (GRCm39)	missense	probably benign
R8864:Spef2	UTSW	15	9,599,833 (GRCm39)	missense	unknown
R8868:Spef2	UTSW	15	9,729,747 (GRCm39)	missense	possibly damaging	0.53
R8916:Spef2	UTSW	15	9,725,266 (GRCm39)	nonsense	probably null
R8935:Spef2	UTSW	15	9,607,436 (GRCm39)	missense	probably damaging	0.98
R8961:Spef2	UTSW	15	9,647,414 (GRCm39)	missense	possibly damaging	0.92
R8978:Spef2	UTSW	15	9,725,263 (GRCm39)	missense	possibly damaging	0.81
R9062:Spef2	UTSW	15	9,601,717 (GRCm39)	missense	unknown
R9076:Spef2	UTSW	15	9,653,091 (GRCm39)	missense	probably benign	0.13
R9149:Spef2	UTSW	15	9,717,568 (GRCm39)	missense	probably damaging	1.00
R9162:Spef2	UTSW	15	9,602,017 (GRCm39)	missense	unknown
R9216:Spef2	UTSW	15	9,647,611 (GRCm39)	missense	probably damaging	1.00
R9240:Spef2	UTSW	15	9,578,401 (GRCm39)	nonsense	probably null
R9278:Spef2	UTSW	15	9,727,495 (GRCm39)	critical splice donor site	probably null
R9341:Spef2	UTSW	15	9,713,190 (GRCm39)	missense	probably damaging	1.00
R9343:Spef2	UTSW	15	9,713,190 (GRCm39)	missense	probably damaging	1.00
R9389:Spef2	UTSW	15	9,725,307 (GRCm39)	missense	probably damaging	0.96
R9476:Spef2	UTSW	15	9,713,203 (GRCm39)	missense	probably damaging	1.00
R9510:Spef2	UTSW	15	9,713,203 (GRCm39)	missense	probably damaging	1.00
R9537:Spef2	UTSW	15	9,601,885 (GRCm39)	missense	unknown
R9575:Spef2	UTSW	15	9,596,672 (GRCm39)	missense	probably damaging	1.00
R9597:Spef2	UTSW	15	9,599,897 (GRCm39)	missense	unknown
R9765:Spef2	UTSW	15	9,601,945 (GRCm39)	missense	unknown
X0025:Spef2	UTSW	15	9,596,708 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGATCCATAGCTGTAGTGTACC -3'
(R):5'- AGTGTCACTGAGCTGTACCC -3'

Sequencing Primer
(F):5'- ATCCATAGCTGTAGTGTACCAGCTG -3'
(R):5'- CACTGAGCTGTACCCTTTAAACTAG -3'

Posted On

2018-11-28