Incidental Mutation 'R0606:Klra2'
Institutional Source Beutler Lab
Gene Symbol Klra2
Ensembl Gene ENSMUSG00000030187
Gene Namekiller cell lectin-like receptor, subfamily A, member 2
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0606 (G1)
Quality Score217
Status Validated
Chromosomal Location131219223-131247362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131220224 bp
Amino Acid Change Cysteine to Serine at position 271 (C271S)
Ref Sequence ENSEMBL: ENSMUSP00000086252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032306] [ENSMUST00000088867]
Predicted Effect probably damaging
Transcript: ENSMUST00000032306
AA Change: C238S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032306
Gene: ENSMUSG00000030187
AA Change: C238S

CLECT 137 260 1.17e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088867
AA Change: C271S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086252
Gene: ENSMUSG00000030187
AA Change: C271S

CLECT 137 293 6.54e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Klra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Klra2 APN 6 131230217 missense probably benign 0.11
IGL02280:Klra2 APN 6 131245293 missense probably damaging 1.00
IGL02503:Klra2 APN 6 131230094 missense probably benign 0.10
IGL03120:Klra2 APN 6 131220217 missense probably benign 0.00
FR4449:Klra2 UTSW 6 131221846 frame shift probably null
FR4548:Klra2 UTSW 6 131221851 frame shift probably null
FR4737:Klra2 UTSW 6 131221852 frame shift probably null
R0082:Klra2 UTSW 6 131220247 missense possibly damaging 0.90
R0597:Klra2 UTSW 6 131220185 missense probably benign 0.00
R0636:Klra2 UTSW 6 131220104 splice site probably benign
R0800:Klra2 UTSW 6 131230174 nonsense probably null
R1645:Klra2 UTSW 6 131243894 critical splice donor site probably null
R1655:Klra2 UTSW 6 131220211 missense probably damaging 0.96
R1950:Klra2 UTSW 6 131230115 missense probably benign 0.02
R2088:Klra2 UTSW 6 131242826 missense probably damaging 0.99
R2402:Klra2 UTSW 6 131243901 missense probably benign 0.01
R3776:Klra2 UTSW 6 131242963 missense probably benign 0.06
R4131:Klra2 UTSW 6 131228217 missense probably benign 0.03
R4570:Klra2 UTSW 6 131243937 missense probably damaging 1.00
R4585:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4586:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4884:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R4982:Klra2 UTSW 6 131220189 missense probably benign 0.25
R5043:Klra2 UTSW 6 131220172 missense probably benign 0.06
R5457:Klra2 UTSW 6 131221889 missense possibly damaging 0.92
R6526:Klra2 UTSW 6 131221876 missense probably benign 0.21
R6538:Klra2 UTSW 6 131242990 missense probably damaging 0.99
R7393:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R7785:Klra2 UTSW 6 131245290 missense possibly damaging 0.95
R8394:Klra2 UTSW 6 131245310 missense possibly damaging 0.94
RF020:Klra2 UTSW 6 131221838 frame shift probably null
RF059:Klra2 UTSW 6 131221838 frame shift probably null
RF064:Klra2 UTSW 6 131221839 frame shift probably null
Z1088:Klra2 UTSW 6 131228290 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtatgggcacatgtcacag -3'
Posted On2013-07-11