Incidental Mutation 'R6957:Gm8251'
ID541483
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6957 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44057207 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1577 (C1577Y)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably benign
Transcript: ENSMUST00000168641
AA Change: C1577Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: C1577Y

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C A 13: 58,381,961 C279F probably damaging Het
2310009B15Rik A G 1: 138,852,119 S132P probably damaging Het
4932415D10Rik A T 10: 82,293,786 I1130K probably benign Het
Abcb5 A G 12: 118,907,535 F710L probably damaging Het
Acsm4 T G 7: 119,711,399 V503G probably damaging Het
Adam26a T A 8: 43,568,903 M517L probably benign Het
Adcy10 C A 1: 165,564,285 L1345I probably damaging Het
Adgrv1 T C 13: 81,567,490 I860V probably benign Het
Alcam T C 16: 52,276,894 D333G probably damaging Het
Amt C A 9: 108,299,833 F213L possibly damaging Het
Ascc3 A G 10: 50,728,182 T1333A probably damaging Het
Asxl3 C A 18: 22,522,091 L1053I probably damaging Het
Atxn10 T C 15: 85,336,498 S12P probably damaging Het
AU021092 T C 16: 5,212,153 I333V probably benign Het
Birc6 A G 17: 74,579,491 I577V probably benign Het
Cadm2 A T 16: 66,812,838 F132I probably benign Het
Casp3 T A 8: 46,634,273 V85D probably damaging Het
Ccdc85a A T 11: 28,392,944 probably benign Het
Cd22 T C 7: 30,867,574 R760G possibly damaging Het
Cela3a A T 4: 137,408,130 W41R probably damaging Het
Cep164 A G 9: 45,772,280 probably null Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Ddx20 C A 3: 105,684,310 K181N probably benign Het
Dnah14 G C 1: 181,785,175 A3846P possibly damaging Het
Ern1 A C 11: 106,403,539 I813S probably damaging Het
Fam181a G A 12: 103,316,514 G226D probably damaging Het
Fam186a T A 15: 99,946,476 D629V unknown Het
Fam84b T C 15: 60,823,085 T271A probably benign Het
Gipr T A 7: 19,164,604 T26S probably benign Het
Gm3159 A G 14: 4,398,530 R74G possibly damaging Het
Greb1l G A 18: 10,558,786 V1814I probably benign Het
Hacd1 A T 2: 14,044,853 V98E probably damaging Het
Iars T G 13: 49,722,161 F775V probably damaging Het
Il12rb2 G A 6: 67,292,652 L726F possibly damaging Het
Itih4 T C 14: 30,892,603 V474A probably damaging Het
Kmt2a A C 9: 44,820,022 probably benign Het
Ktn1 T A 14: 47,667,353 L196* probably null Het
Lipo4 A G 19: 33,499,367 V327A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp4 C A 2: 91,487,042 T837K probably damaging Het
Mad1l1 G T 5: 140,065,817 F664L probably damaging Het
Mecr A G 4: 131,861,861 T247A probably benign Het
Msi1 G A 5: 115,445,424 A228T probably benign Het
Mup5 T A 4: 61,833,036 N125I probably damaging Het
Mybl2 C T 2: 163,072,808 S282F possibly damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nalcn T C 14: 123,507,554 D354G probably damaging Het
Nckap1l T C 15: 103,491,511 V1040A possibly damaging Het
Nlrp12 T A 7: 3,222,486 D1051V probably damaging Het
Nudt7 A G 8: 114,133,645 K16R probably benign Het
Olfr1270 G T 2: 90,149,150 Y285* probably null Het
Olfr947-ps1 A G 9: 39,289,281 V203A unknown Het
Paqr3 A T 5: 97,108,251 I88K possibly damaging Het
Parp9 A G 16: 35,948,346 M299V probably benign Het
Pde4dip A T 3: 97,824,333 probably null Het
Pex13 T G 11: 23,655,628 M201L probably benign Het
Pfas C A 11: 68,993,883 V498L probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Plec T A 15: 76,186,214 D932V probably damaging Het
Qsox2 C T 2: 26,217,642 A445T probably benign Het
Rapgef1 C A 2: 29,733,698 Q820K possibly damaging Het
Samd13 A G 3: 146,662,669 probably null Het
Samm50 G T 15: 84,198,649 D104Y probably damaging Het
Sbk3 A T 7: 4,967,523 F282L probably benign Het
Sfmbt1 C T 14: 30,787,589 H342Y probably benign Het
Sgo2b CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT 8: 63,931,455 probably benign Het
Slc12a2 T A 18: 57,910,272 L596* probably null Het
St8sia3 T C 18: 64,271,782 S377P probably benign Het
Stmnd1 T G 13: 46,273,899 S28A probably benign Het
Syne3 A T 12: 104,954,302 L458Q probably damaging Het
Synm C T 7: 67,736,100 V163I probably benign Het
Tbc1d23 A G 16: 57,208,323 C161R probably damaging Het
Tnfrsf4 G A 4: 156,016,168 V215I probably benign Het
Vars2 T G 17: 35,667,075 K67Q probably benign Het
Vmn2r13 A T 5: 109,156,887 Y559* probably null Het
Wdpcp T C 11: 21,721,154 I465T possibly damaging Het
Zwilch A C 9: 64,162,562 probably null Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTTCAGTGTCTCGTAGGCC -3'
(R):5'- TGGAGATACATACAATGGGCC -3'

Sequencing Primer
(F):5'- TCTCGTAGGCCAGGGTAAAAGTC -3'
(R):5'- ATTTAAGTGCATCCATACTGCCACG -3'
Posted On2018-11-28