Incidental Mutation 'R6957:Cela3a'
ID541499
Institutional Source Beutler Lab
Gene Symbol Cela3a
Ensembl Gene ENSMUSG00000078520
Gene Namechymotrypsin-like elastase family, member 3A
SynonymsGm13011
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6957 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location137401554-137409791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137408130 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 41 (W41R)
Ref Sequence ENSEMBL: ENSMUSP00000024200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024200]
Predicted Effect probably damaging
Transcript: ENSMUST00000024200
AA Change: W41R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024200
Gene: ENSMUSG00000078520
AA Change: W41R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Tryp_SPc 27 276 2.6e-82 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, elastase 3A has little elastolytic activity. Like most of the human elastases, elastase 3A is secreted from the pancreas as a zymogen and, like other serine proteases such as trypsin, chymotrypsin and kallikrein, it has a digestive function in the intestine. Elastase 3A preferentially cleaves proteins after alanine residues. Elastase 3A may also function in the intestinal transport and metabolism of cholesterol. Both elastase 3A and elastase 3B have been referred to as protease E and as elastase 1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C A 13: 58,381,961 C279F probably damaging Het
2310009B15Rik A G 1: 138,852,119 S132P probably damaging Het
4932415D10Rik A T 10: 82,293,786 I1130K probably benign Het
Abcb5 A G 12: 118,907,535 F710L probably damaging Het
Acsm4 T G 7: 119,711,399 V503G probably damaging Het
Adam26a T A 8: 43,568,903 M517L probably benign Het
Adcy10 C A 1: 165,564,285 L1345I probably damaging Het
Adgrv1 T C 13: 81,567,490 I860V probably benign Het
Alcam T C 16: 52,276,894 D333G probably damaging Het
Amt C A 9: 108,299,833 F213L possibly damaging Het
Ascc3 A G 10: 50,728,182 T1333A probably damaging Het
Asxl3 C A 18: 22,522,091 L1053I probably damaging Het
Atxn10 T C 15: 85,336,498 S12P probably damaging Het
AU021092 T C 16: 5,212,153 I333V probably benign Het
Birc6 A G 17: 74,579,491 I577V probably benign Het
Cadm2 A T 16: 66,812,838 F132I probably benign Het
Casp3 T A 8: 46,634,273 V85D probably damaging Het
Ccdc85a A T 11: 28,392,944 probably benign Het
Cd22 T C 7: 30,867,574 R760G possibly damaging Het
Cep164 A G 9: 45,772,280 probably null Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Ddx20 C A 3: 105,684,310 K181N probably benign Het
Dnah14 G C 1: 181,785,175 A3846P possibly damaging Het
Ern1 A C 11: 106,403,539 I813S probably damaging Het
Fam181a G A 12: 103,316,514 G226D probably damaging Het
Fam186a T A 15: 99,946,476 D629V unknown Het
Fam84b T C 15: 60,823,085 T271A probably benign Het
Gipr T A 7: 19,164,604 T26S probably benign Het
Gm3159 A G 14: 4,398,530 R74G possibly damaging Het
Gm8251 C T 1: 44,057,207 C1577Y probably benign Het
Greb1l G A 18: 10,558,786 V1814I probably benign Het
Hacd1 A T 2: 14,044,853 V98E probably damaging Het
Iars T G 13: 49,722,161 F775V probably damaging Het
Il12rb2 G A 6: 67,292,652 L726F possibly damaging Het
Itih4 T C 14: 30,892,603 V474A probably damaging Het
Kmt2a A C 9: 44,820,022 probably benign Het
Ktn1 T A 14: 47,667,353 L196* probably null Het
Lipo4 A G 19: 33,499,367 V327A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp4 C A 2: 91,487,042 T837K probably damaging Het
Mad1l1 G T 5: 140,065,817 F664L probably damaging Het
Mecr A G 4: 131,861,861 T247A probably benign Het
Msi1 G A 5: 115,445,424 A228T probably benign Het
Mup5 T A 4: 61,833,036 N125I probably damaging Het
Mybl2 C T 2: 163,072,808 S282F possibly damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nalcn T C 14: 123,507,554 D354G probably damaging Het
Nckap1l T C 15: 103,491,511 V1040A possibly damaging Het
Nlrp12 T A 7: 3,222,486 D1051V probably damaging Het
Nudt7 A G 8: 114,133,645 K16R probably benign Het
Olfr1270 G T 2: 90,149,150 Y285* probably null Het
Olfr947-ps1 A G 9: 39,289,281 V203A unknown Het
Paqr3 A T 5: 97,108,251 I88K possibly damaging Het
Parp9 A G 16: 35,948,346 M299V probably benign Het
Pde4dip A T 3: 97,824,333 probably null Het
Pex13 T G 11: 23,655,628 M201L probably benign Het
Pfas C A 11: 68,993,883 V498L probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Plec T A 15: 76,186,214 D932V probably damaging Het
Qsox2 C T 2: 26,217,642 A445T probably benign Het
Rapgef1 C A 2: 29,733,698 Q820K possibly damaging Het
Samd13 A G 3: 146,662,669 probably null Het
Samm50 G T 15: 84,198,649 D104Y probably damaging Het
Sbk3 A T 7: 4,967,523 F282L probably benign Het
Sfmbt1 C T 14: 30,787,589 H342Y probably benign Het
Sgo2b CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT 8: 63,931,455 probably benign Het
Slc12a2 T A 18: 57,910,272 L596* probably null Het
St8sia3 T C 18: 64,271,782 S377P probably benign Het
Stmnd1 T G 13: 46,273,899 S28A probably benign Het
Syne3 A T 12: 104,954,302 L458Q probably damaging Het
Synm C T 7: 67,736,100 V163I probably benign Het
Tbc1d23 A G 16: 57,208,323 C161R probably damaging Het
Tnfrsf4 G A 4: 156,016,168 V215I probably benign Het
Vars2 T G 17: 35,667,075 K67Q probably benign Het
Vmn2r13 A T 5: 109,156,887 Y559* probably null Het
Wdpcp T C 11: 21,721,154 I465T possibly damaging Het
Zwilch A C 9: 64,162,562 probably null Het
Other mutations in Cela3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02830:Cela3a APN 4 137401635 missense probably benign 0.00
IGL02869:Cela3a APN 4 137403834 missense probably benign 0.13
IGL02968:Cela3a APN 4 137403821 missense probably damaging 1.00
R0496:Cela3a UTSW 4 137404468 missense probably damaging 1.00
R1681:Cela3a UTSW 4 137402684 critical splice acceptor site probably null
R2092:Cela3a UTSW 4 137404426 missense probably benign 0.03
R2277:Cela3a UTSW 4 137405876 missense possibly damaging 0.88
R4766:Cela3a UTSW 4 137402675 missense unknown
R4960:Cela3a UTSW 4 137402648 nonsense probably null
R6666:Cela3a UTSW 4 137403864 missense probably benign 0.04
R6842:Cela3a UTSW 4 137405668 missense probably benign 0.00
R7347:Cela3a UTSW 4 137402606 missense possibly damaging 0.95
R7425:Cela3a UTSW 4 137405588 missense probably benign 0.00
R7499:Cela3a UTSW 4 137405639 missense probably damaging 0.96
R7543:Cela3a UTSW 4 137402572 missense probably damaging 0.99
R7702:Cela3a UTSW 4 137408190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCCAAGAAATGTCTCTGTCC -3'
(R):5'- CTAGAGAGGGGAAGGGCTCC -3'

Sequencing Primer
(F):5'- CCAAGAGTTTCCGGCCTTTTGAAG -3'
(R):5'- TCACTATATAGGTCAAGCTGGCC -3'
Posted On2018-11-28