Incidental Mutation 'R6957:Nlrp12'
ID541506
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6957 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3222486 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1051 (D1051V)
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect probably damaging
Transcript: ENSMUST00000108653
AA Change: D1051V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817
AA Change: D1051V

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C A 13: 58,381,961 C279F probably damaging Het
2310009B15Rik A G 1: 138,852,119 S132P probably damaging Het
4932415D10Rik A T 10: 82,293,786 I1130K probably benign Het
Abcb5 A G 12: 118,907,535 F710L probably damaging Het
Acsm4 T G 7: 119,711,399 V503G probably damaging Het
Adam26a T A 8: 43,568,903 M517L probably benign Het
Adcy10 C A 1: 165,564,285 L1345I probably damaging Het
Adgrv1 T C 13: 81,567,490 I860V probably benign Het
Alcam T C 16: 52,276,894 D333G probably damaging Het
Amt C A 9: 108,299,833 F213L possibly damaging Het
Ascc3 A G 10: 50,728,182 T1333A probably damaging Het
Asxl3 C A 18: 22,522,091 L1053I probably damaging Het
Atxn10 T C 15: 85,336,498 S12P probably damaging Het
AU021092 T C 16: 5,212,153 I333V probably benign Het
Birc6 A G 17: 74,579,491 I577V probably benign Het
Cadm2 A T 16: 66,812,838 F132I probably benign Het
Casp3 T A 8: 46,634,273 V85D probably damaging Het
Ccdc85a A T 11: 28,392,944 probably benign Het
Cd22 T C 7: 30,867,574 R760G possibly damaging Het
Cela3a A T 4: 137,408,130 W41R probably damaging Het
Cep164 A G 9: 45,772,280 probably null Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Ddx20 C A 3: 105,684,310 K181N probably benign Het
Dnah14 G C 1: 181,785,175 A3846P possibly damaging Het
Ern1 A C 11: 106,403,539 I813S probably damaging Het
Fam181a G A 12: 103,316,514 G226D probably damaging Het
Fam186a T A 15: 99,946,476 D629V unknown Het
Fam84b T C 15: 60,823,085 T271A probably benign Het
Gipr T A 7: 19,164,604 T26S probably benign Het
Gm3159 A G 14: 4,398,530 R74G possibly damaging Het
Gm8251 C T 1: 44,057,207 C1577Y probably benign Het
Greb1l G A 18: 10,558,786 V1814I probably benign Het
Hacd1 A T 2: 14,044,853 V98E probably damaging Het
Iars T G 13: 49,722,161 F775V probably damaging Het
Il12rb2 G A 6: 67,292,652 L726F possibly damaging Het
Itih4 T C 14: 30,892,603 V474A probably damaging Het
Kmt2a A C 9: 44,820,022 probably benign Het
Ktn1 T A 14: 47,667,353 L196* probably null Het
Lipo4 A G 19: 33,499,367 V327A probably benign Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp4 C A 2: 91,487,042 T837K probably damaging Het
Mad1l1 G T 5: 140,065,817 F664L probably damaging Het
Mecr A G 4: 131,861,861 T247A probably benign Het
Msi1 G A 5: 115,445,424 A228T probably benign Het
Mup5 T A 4: 61,833,036 N125I probably damaging Het
Mybl2 C T 2: 163,072,808 S282F possibly damaging Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nalcn T C 14: 123,507,554 D354G probably damaging Het
Nckap1l T C 15: 103,491,511 V1040A possibly damaging Het
Nudt7 A G 8: 114,133,645 K16R probably benign Het
Olfr1270 G T 2: 90,149,150 Y285* probably null Het
Olfr947-ps1 A G 9: 39,289,281 V203A unknown Het
Paqr3 A T 5: 97,108,251 I88K possibly damaging Het
Parp9 A G 16: 35,948,346 M299V probably benign Het
Pde4dip A T 3: 97,824,333 probably null Het
Pex13 T G 11: 23,655,628 M201L probably benign Het
Pfas C A 11: 68,993,883 V498L probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Plec T A 15: 76,186,214 D932V probably damaging Het
Qsox2 C T 2: 26,217,642 A445T probably benign Het
Rapgef1 C A 2: 29,733,698 Q820K possibly damaging Het
Samd13 A G 3: 146,662,669 probably null Het
Samm50 G T 15: 84,198,649 D104Y probably damaging Het
Sbk3 A T 7: 4,967,523 F282L probably benign Het
Sfmbt1 C T 14: 30,787,589 H342Y probably benign Het
Sgo2b CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT 8: 63,931,455 probably benign Het
Slc12a2 T A 18: 57,910,272 L596* probably null Het
St8sia3 T C 18: 64,271,782 S377P probably benign Het
Stmnd1 T G 13: 46,273,899 S28A probably benign Het
Syne3 A T 12: 104,954,302 L458Q probably damaging Het
Synm C T 7: 67,736,100 V163I probably benign Het
Tbc1d23 A G 16: 57,208,323 C161R probably damaging Het
Tnfrsf4 G A 4: 156,016,168 V215I probably benign Het
Vars2 T G 17: 35,667,075 K67Q probably benign Het
Vmn2r13 A T 5: 109,156,887 Y559* probably null Het
Wdpcp T C 11: 21,721,154 I465T possibly damaging Het
Zwilch A C 9: 64,162,562 probably null Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R5891:Nlrp12 UTSW 7 3219259 utr 3 prime probably benign
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
R7729:Nlrp12 UTSW 7 3228388 critical splice donor site probably null
R7793:Nlrp12 UTSW 7 3245400 missense probably benign
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1176:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Z1177:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGTCAACCTGCACTTACTGGG -3'
(R):5'- AGACTGACCTGTGCAAGAGC -3'

Sequencing Primer
(F):5'- TACTGGGCCTCCTGACCTAAGAC -3'
(R):5'- GAAGCATACGATCAAGCCTCAG -3'
Posted On2018-11-28