Mutagenetix > Incidental Mutation

Incidental Mutation 'R6957:Pfas'

541527

Institutional Source

Beutler Lab

Gene Symbol

Pfas

Ensembl Gene

ENSMUSG00000020899

Gene Name

phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)

Synonyms

4432409B16Rik, Sofa

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6957 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

68985697-69008460 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 68993883 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 498 (V498L)

Ref Sequence

ENSEMBL: ENSMUSP00000021282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021282]

AlphaFold

Q5SUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000021282
AA Change: V498L

PolyPhen 2 Score 0.138 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: V498L

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	444	603	1.7e-21	PFAM
low complexity region	615	632	N/A	INTRINSIC
low complexity region	786	798	N/A	INTRINSIC
Pfam:AIRS_C	853	988	3e-11	PFAM
GATase_5	1061	1332	8.38e-133	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000133984
Gene: ENSMUSG00000020899
AA Change: V52L

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	3	110	4e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152964

SMART Domains

Protein: ENSMUSP00000121808
Gene: ENSMUSG00000020899

Domain	Start	End	E-Value	Type
Pfam:AIRS_C	2	94	1.6e-12	PFAM
GATase_5	166	468	6.88e-120	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	C	A	13: 58,381,961	C279F	probably damaging	Het
2310009B15Rik	A	G	1: 138,852,119	S132P	probably damaging	Het
4932415D10Rik	A	T	10: 82,293,786	I1130K	probably benign	Het
Abcb5	A	G	12: 118,907,535	F710L	probably damaging	Het
Acsm4	T	G	7: 119,711,399	V503G	probably damaging	Het
Adam26a	T	A	8: 43,568,903	M517L	probably benign	Het
Adcy10	C	A	1: 165,564,285	L1345I	probably damaging	Het
Adgrv1	T	C	13: 81,567,490	I860V	probably benign	Het
Alcam	T	C	16: 52,276,894	D333G	probably damaging	Het
Amt	C	A	9: 108,299,833	F213L	possibly damaging	Het
Ascc3	A	G	10: 50,728,182	T1333A	probably damaging	Het
Asxl3	C	A	18: 22,522,091	L1053I	probably damaging	Het
Atxn10	T	C	15: 85,336,498	S12P	probably damaging	Het
AU021092	T	C	16: 5,212,153	I333V	probably benign	Het
Birc6	A	G	17: 74,579,491	I577V	probably benign	Het
Cadm2	A	T	16: 66,812,838	F132I	probably benign	Het
Casp3	T	A	8: 46,634,273	V85D	probably damaging	Het
Ccdc85a	A	T	11: 28,392,944		probably benign	Het
Cd22	T	C	7: 30,867,574	R760G	possibly damaging	Het
Cela3a	A	T	4: 137,408,130	W41R	probably damaging	Het
Cep164	A	G	9: 45,772,280		probably null	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Ddx20	C	A	3: 105,684,310	K181N	probably benign	Het
Dnah14	G	C	1: 181,785,175	A3846P	possibly damaging	Het
Ern1	A	C	11: 106,403,539	I813S	probably damaging	Het
Fam181a	G	A	12: 103,316,514	G226D	probably damaging	Het
Fam186a	T	A	15: 99,946,476	D629V	unknown	Het
Fam84b	T	C	15: 60,823,085	T271A	probably benign	Het
Gipr	T	A	7: 19,164,604	T26S	probably benign	Het
Gm3159	A	G	14: 4,398,530	R74G	possibly damaging	Het
Gm8251	C	T	1: 44,057,207	C1577Y	probably benign	Het
Greb1l	G	A	18: 10,558,786	V1814I	probably benign	Het
Hacd1	A	T	2: 14,044,853	V98E	probably damaging	Het
Iars	T	G	13: 49,722,161	F775V	probably damaging	Het
Il12rb2	G	A	6: 67,292,652	L726F	possibly damaging	Het
Itih4	T	C	14: 30,892,603	V474A	probably damaging	Het
Kmt2a	A	C	9: 44,820,022		probably benign	Het
Ktn1	T	A	14: 47,667,353	L196*	probably null	Het
Lipo4	A	G	19: 33,499,367	V327A	probably benign	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Lrp4	C	A	2: 91,487,042	T837K	probably damaging	Het
Mad1l1	G	T	5: 140,065,817	F664L	probably damaging	Het
Mecr	A	G	4: 131,861,861	T247A	probably benign	Het
Msi1	G	A	5: 115,445,424	A228T	probably benign	Het
Mup5	T	A	4: 61,833,036	N125I	probably damaging	Het
Mybl2	C	T	2: 163,072,808	S282F	possibly damaging	Het
Myom2	G	A	8: 15,117,741	A1109T	probably null	Het
Nalcn	T	C	14: 123,507,554	D354G	probably damaging	Het
Nckap1l	T	C	15: 103,491,511	V1040A	possibly damaging	Het
Nlrp12	T	A	7: 3,222,486	D1051V	probably damaging	Het
Nudt7	A	G	8: 114,133,645	K16R	probably benign	Het
Olfr1270	G	T	2: 90,149,150	Y285*	probably null	Het
Olfr947-ps1	A	G	9: 39,289,281	V203A	unknown	Het
Paqr3	A	T	5: 97,108,251	I88K	possibly damaging	Het
Parp9	A	G	16: 35,948,346	M299V	probably benign	Het
Pde4dip	A	T	3: 97,824,333		probably null	Het
Pex13	T	G	11: 23,655,628	M201L	probably benign	Het
Phka2	G	A	X: 160,533,048	V230I	probably damaging	Het
Plec	T	A	15: 76,186,214	D932V	probably damaging	Het
Qsox2	C	T	2: 26,217,642	A445T	probably benign	Het
Rapgef1	C	A	2: 29,733,698	Q820K	possibly damaging	Het
Samd13	A	G	3: 146,662,669		probably null	Het
Samm50	G	T	15: 84,198,649	D104Y	probably damaging	Het
Sbk3	A	T	7: 4,967,523	F282L	probably benign	Het
Sfmbt1	C	T	14: 30,787,589	H342Y	probably benign	Het
Sgo2b	CCATCATCATCATCATCATCAT	CCATCATCATCATCATCAT	8: 63,931,455		probably benign	Het
Slc12a2	T	A	18: 57,910,272	L596*	probably null	Het
St8sia3	T	C	18: 64,271,782	S377P	probably benign	Het
Stmnd1	T	G	13: 46,273,899	S28A	probably benign	Het
Syne3	A	T	12: 104,954,302	L458Q	probably damaging	Het
Synm	C	T	7: 67,736,100	V163I	probably benign	Het
Tbc1d23	A	G	16: 57,208,323	C161R	probably damaging	Het
Tnfrsf4	G	A	4: 156,016,168	V215I	probably benign	Het
Vars2	T	G	17: 35,667,075	K67Q	probably benign	Het
Vmn2r13	A	T	5: 109,156,887	Y559*	probably null	Het
Wdpcp	T	C	11: 21,721,154	I465T	possibly damaging	Het
Zwilch	A	C	9: 64,162,562		probably null	Het

Other mutations in Pfas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Pfas	APN	11	69003814	nonsense	probably null
IGL01287:Pfas	APN	11	69001260	missense	probably benign	0.09
IGL01712:Pfas	APN	11	68991060	missense	probably benign	0.34
IGL02019:Pfas	APN	11	68993463	unclassified	probably benign
IGL02053:Pfas	APN	11	68992953	missense	probably damaging	1.00
IGL02718:Pfas	APN	11	69000145	splice site	probably benign
IGL02801:Pfas	APN	11	68988277	unclassified	probably benign
Surf	UTSW	11	68988021	missense	probably damaging	1.00
PIT4812001:Pfas	UTSW	11	68990036	missense
R0037:Pfas	UTSW	11	69000036	missense	probably damaging	1.00
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0046:Pfas	UTSW	11	68990467	missense	probably benign
R0408:Pfas	UTSW	11	69001105	critical splice donor site	probably null
R0532:Pfas	UTSW	11	69002629	splice site	probably benign
R0707:Pfas	UTSW	11	68998037	missense	probably benign	0.00
R0783:Pfas	UTSW	11	69000521	missense	probably damaging	1.00
R0946:Pfas	UTSW	11	68993295	critical splice donor site	probably null
R0946:Pfas	UTSW	11	68990747	splice site	probably null
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1470:Pfas	UTSW	11	68991359	missense	probably benign
R1507:Pfas	UTSW	11	68990034	missense	probably benign	0.06
R1699:Pfas	UTSW	11	68998046	critical splice acceptor site	probably null
R1870:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1871:Pfas	UTSW	11	68991969	missense	probably damaging	1.00
R1959:Pfas	UTSW	11	68994284	missense	probably damaging	1.00
R2026:Pfas	UTSW	11	68993957	missense	probably damaging	1.00
R2180:Pfas	UTSW	11	68992187	missense	possibly damaging	0.92
R3808:Pfas	UTSW	11	68989953	intron	probably benign
R3809:Pfas	UTSW	11	68989953	intron	probably benign
R3872:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R3906:Pfas	UTSW	11	68988286	unclassified	probably benign
R4092:Pfas	UTSW	11	68993949	missense	probably benign
R4437:Pfas	UTSW	11	68988417	missense	probably damaging	1.00
R4599:Pfas	UTSW	11	68991069	missense	probably benign	0.15
R4763:Pfas	UTSW	11	68990194	missense	possibly damaging	0.81
R5116:Pfas	UTSW	11	68990990	intron	probably benign
R5310:Pfas	UTSW	11	68988021	missense	probably damaging	1.00
R5328:Pfas	UTSW	11	68988592	missense	probably damaging	1.00
R5351:Pfas	UTSW	11	68991391	missense	probably damaging	1.00
R5427:Pfas	UTSW	11	69001153	missense	possibly damaging	0.90
R5533:Pfas	UTSW	11	68991470	missense	probably benign	0.02
R5602:Pfas	UTSW	11	68991045	missense	probably benign	0.05
R5637:Pfas	UTSW	11	68993323	missense	probably damaging	1.00
R5645:Pfas	UTSW	11	68991132	missense	probably damaging	1.00
R6149:Pfas	UTSW	11	68991945	missense	probably benign	0.07
R6295:Pfas	UTSW	11	68997999	missense	probably benign	0.36
R6305:Pfas	UTSW	11	69001197	missense	possibly damaging	0.51
R6387:Pfas	UTSW	11	69000465	missense	probably damaging	1.00
R6425:Pfas	UTSW	11	68991071	missense	probably benign	0.17
R6523:Pfas	UTSW	11	68990457	missense	probably benign
R6914:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6915:Pfas	UTSW	11	68992181	missense	probably benign	0.01
R6945:Pfas	UTSW	11	69000530	missense	probably benign
R7025:Pfas	UTSW	11	68990760	missense	probably benign	0.01
R7257:Pfas	UTSW	11	68992959	missense	probably damaging	1.00
R7386:Pfas	UTSW	11	69003774	missense	probably benign
R7424:Pfas	UTSW	11	69000092	missense	probably damaging	1.00
R7459:Pfas	UTSW	11	68988655	missense
R7593:Pfas	UTSW	11	68991095	missense
R7731:Pfas	UTSW	11	69000045	missense	probably damaging	1.00
R8103:Pfas	UTSW	11	68992293	missense	probably damaging	0.98
R8248:Pfas	UTSW	11	69000263	missense	probably damaging	1.00
R8804:Pfas	UTSW	11	68991082	missense
R8853:Pfas	UTSW	11	68992918	missense	probably damaging	1.00
R9032:Pfas	UTSW	11	68988595	missense
R9050:Pfas	UTSW	11	68991741	missense	probably benign	0.01
R9283:Pfas	UTSW	11	68993882	missense	probably damaging	1.00
R9644:Pfas	UTSW	11	68992716	missense	probably benign	0.23
Z1176:Pfas	UTSW	11	68990070	missense
Z1176:Pfas	UTSW	11	69002487	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	68990225	missense	probably damaging	1.00
Z1177:Pfas	UTSW	11	69002493	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTAGTCATGGTCAGCCCC -3'
(R):5'- CACCTTTCCTATGACTGGGC -3'

Sequencing Primer
(F):5'- TCCATAGTGCCTAAAATCCTGTG -3'
(R):5'- TATGACTGGGCCCCACTGTG -3'

Posted On

2018-11-28