Incidental Mutation 'R0606:Nktr'
ID54156
Institutional Source Beutler Lab
Gene Symbol Nktr
Ensembl Gene ENSMUSG00000032525
Gene Namenatural killer tumor recognition sequence
Synonyms5330401F18Rik, D9Wsu172e
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.588) question?
Stock #R0606 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location121719169-121756843 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 121749290 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035112] [ENSMUST00000182179] [ENSMUST00000182225] [ENSMUST00000182503]
Predicted Effect unknown
Transcript: ENSMUST00000035112
AA Change: D808G
SMART Domains Protein: ENSMUSP00000035112
Gene: ENSMUSG00000032525
AA Change: D808G

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 1.7e-48 PFAM
low complexity region 195 229 N/A INTRINSIC
low complexity region 277 294 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
low complexity region 427 459 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
low complexity region 509 565 N/A INTRINSIC
low complexity region 677 726 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 921 929 N/A INTRINSIC
low complexity region 948 958 N/A INTRINSIC
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1189 1200 N/A INTRINSIC
low complexity region 1229 1236 N/A INTRINSIC
low complexity region 1316 1453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182076
Predicted Effect probably benign
Transcript: ENSMUST00000182179
SMART Domains Protein: ENSMUSP00000138437
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000182225
AA Change: D783G
SMART Domains Protein: ENSMUSP00000138168
Gene: ENSMUSG00000032525
AA Change: D783G

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 2.1e-47 PFAM
low complexity region 184 215 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
low complexity region 402 434 N/A INTRINSIC
low complexity region 452 478 N/A INTRINSIC
low complexity region 484 540 N/A INTRINSIC
low complexity region 652 701 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
low complexity region 875 889 N/A INTRINSIC
low complexity region 896 904 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182503
SMART Domains Protein: ENSMUSP00000138463
Gene: ENSMUSG00000032525

DomainStartEndE-ValueType
low complexity region 10 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182607
Predicted Effect probably benign
Transcript: ENSMUST00000182713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213351
Meta Mutation Damage Score 0.0882 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Dnah9 T C 11: 65,841,333 Y4249C probably damaging Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Nktr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Nktr APN 9 121731564 missense possibly damaging 0.94
IGL01402:Nktr APN 9 121741152 splice site probably null
IGL01404:Nktr APN 9 121741152 splice site probably null
IGL02945:Nktr APN 9 121728631 missense probably damaging 1.00
IGL03334:Nktr APN 9 121748176 missense probably benign 0.18
IGL03134:Nktr UTSW 9 121746466 missense probably damaging 1.00
PIT4131001:Nktr UTSW 9 121741621 missense probably damaging 1.00
R0010:Nktr UTSW 9 121741166 splice site probably benign
R0158:Nktr UTSW 9 121750691 unclassified probably benign
R0399:Nktr UTSW 9 121731484 missense probably damaging 0.98
R0503:Nktr UTSW 9 121750740 unclassified probably benign
R0585:Nktr UTSW 9 121754280 utr 3 prime probably benign
R1248:Nktr UTSW 9 121727370 missense probably damaging 1.00
R1899:Nktr UTSW 9 121748866 unclassified probably benign
R1912:Nktr UTSW 9 121750240 unclassified probably benign
R2049:Nktr UTSW 9 121741694 missense probably damaging 1.00
R2279:Nktr UTSW 9 121731537 missense possibly damaging 0.93
R2912:Nktr UTSW 9 121749604 unclassified probably benign
R2913:Nktr UTSW 9 121749604 unclassified probably benign
R2914:Nktr UTSW 9 121749604 unclassified probably benign
R3939:Nktr UTSW 9 121749069 unclassified probably benign
R4080:Nktr UTSW 9 121741126 missense probably damaging 1.00
R4471:Nktr UTSW 9 121748896 unclassified probably benign
R4472:Nktr UTSW 9 121748896 unclassified probably benign
R4506:Nktr UTSW 9 121748883 unclassified probably benign
R4556:Nktr UTSW 9 121741123 missense probably damaging 0.98
R4736:Nktr UTSW 9 121749739 unclassified probably benign
R4749:Nktr UTSW 9 121741693 missense probably damaging 1.00
R4943:Nktr UTSW 9 121719954 intron probably benign
R5084:Nktr UTSW 9 121748110 missense possibly damaging 0.86
R5250:Nktr UTSW 9 121749792 unclassified probably benign
R5288:Nktr UTSW 9 121748593 missense probably benign 0.23
R5324:Nktr UTSW 9 121727346 missense probably damaging 1.00
R5330:Nktr UTSW 9 121752768 intron probably benign
R5331:Nktr UTSW 9 121752768 intron probably benign
R5502:Nktr UTSW 9 121748606 unclassified probably benign
R5587:Nktr UTSW 9 121748489 unclassified probably benign
R5664:Nktr UTSW 9 121749417 nonsense probably null
R6005:Nktr UTSW 9 121748394 unclassified probably benign
R6057:Nktr UTSW 9 121748389 unclassified probably benign
R6083:Nktr UTSW 9 121750136 unclassified probably benign
R6274:Nktr UTSW 9 121731565 missense probably damaging 1.00
R6445:Nktr UTSW 9 121748414 unclassified probably benign
R6467:Nktr UTSW 9 121731519 missense probably damaging 1.00
R6911:Nktr UTSW 9 121754326 nonsense probably null
R6960:Nktr UTSW 9 121742692 missense probably damaging 0.99
R7226:Nktr UTSW 9 121746533 missense probably damaging 0.99
R7324:Nktr UTSW 9 121727361 missense probably damaging 1.00
R7324:Nktr UTSW 9 121748291 missense possibly damaging 0.66
R7451:Nktr UTSW 9 121729656 missense probably damaging 0.99
R7464:Nktr UTSW 9 121750327 missense unknown
R7537:Nktr UTSW 9 121749279 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTCCCAGCACAGTAGGTCATCTTC -3'
(R):5'- GCACAATTCTTCCCTTTGGACACAC -3'

Sequencing Primer
(F):5'- CAGCACAGTAGGTCATCTTCATATAC -3'
(R):5'- CCCTTTGGACACACTGTCATC -3'
Posted On2013-07-11