Incidental Mutation 'R6958:Elk4'
ID541564
Institutional Source Beutler Lab
Gene Symbol Elk4
Ensembl Gene ENSMUSG00000026436
Gene NameELK4, member of ETS oncogene family
SynonymsSap1, A130026I01Rik, 2310011G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location132007607-132032612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132017832 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 149 (F149L)
Ref Sequence ENSEMBL: ENSMUSP00000118880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027696] [ENSMUST00000086556] [ENSMUST00000126927] [ENSMUST00000146432]
Predicted Effect probably damaging
Transcript: ENSMUST00000027696
AA Change: F149L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027696
Gene: ENSMUSG00000026436
AA Change: F149L

DomainStartEndE-ValueType
ETS 4 89 4.95e-58 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
low complexity region 245 264 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086556
AA Change: F149L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083743
Gene: ENSMUSG00000026436
AA Change: F149L

DomainStartEndE-ValueType
ETS 4 89 4.95e-58 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
low complexity region 245 264 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126927
SMART Domains Protein: ENSMUSP00000116706
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146432
AA Change: F149L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118880
Gene: ENSMUSG00000026436
AA Change: F149L

DomainStartEndE-ValueType
ETS 4 89 4.95e-58 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
low complexity region 245 264 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114255
Gene: ENSMUSG00000026436
AA Change: F8L

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 105 124 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum reponse element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is phosphorylated by the kinases, MAPK1 and MAPK8. Several transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this locus impairs thymocyte positive selection and results in reduced numbers of single-positive thymocytes and peripheral T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Elk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Elk4 APN 1 132017854 missense possibly damaging 0.49
IGL02376:Elk4 APN 1 132014550 missense probably benign 0.27
IGL02503:Elk4 APN 1 132014539 missense probably damaging 1.00
IGL02620:Elk4 APN 1 132018371 missense probably benign 0.14
IGL03217:Elk4 APN 1 132018040 missense probably benign 0.09
R1386:Elk4 UTSW 1 132017830 missense probably damaging 1.00
R4937:Elk4 UTSW 1 132017681 missense probably damaging 1.00
R7025:Elk4 UTSW 1 132019369 missense probably damaging 1.00
R7189:Elk4 UTSW 1 132019389 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAAGTTTGTGTACAAGTTTGTCTCC -3'
(R):5'- ACTAGGGCTCGTTGCAAAGG -3'

Sequencing Primer
(F):5'- GTACAAGTTTGTCTCCTATCCAGAG -3'
(R):5'- AGGCAGCAGCGACAGGC -3'
Posted On2018-11-28