Incidental Mutation 'R6958:Ankrd16'
ID 541566
Institutional Source Beutler Lab
Gene Symbol Ankrd16
Ensembl Gene ENSMUSG00000047909
Gene Name ankyrin repeat domain 16
Synonyms 2810455F06Rik, D430029B21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock # R6958 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 11777876-11790329 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11779793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 144 (A144V)
Ref Sequence ENSEMBL: ENSMUSP00000052056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056108] [ENSMUST00000071564] [ENSMUST00000130186] [ENSMUST00000133664] [ENSMUST00000156067]
AlphaFold A2AS55
Predicted Effect probably damaging
Transcript: ENSMUST00000056108
AA Change: A144V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052056
Gene: ENSMUSG00000047909
AA Change: A144V

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 167 1.74e0 SMART
ANK 170 200 7.71e-2 SMART
ANK 204 233 5.01e-1 SMART
ANK 238 268 1.37e2 SMART
ANK 273 302 7.53e-5 SMART
ANK 306 336 4.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071564
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128774
SMART Domains Protein: ENSMUSP00000121218
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
Pfam:Ank_4 10 65 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130186
SMART Domains Protein: ENSMUSP00000141685
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
ANK 36 66 7.2e-3 SMART
Pfam:Ank 72 90 7.9e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133664
SMART Domains Protein: ENSMUSP00000115226
Gene: ENSMUSG00000047909

DomainStartEndE-ValueType
Pfam:Ank 1 29 1.5e-3 PFAM
Pfam:Ank_4 1 51 7.3e-11 PFAM
Pfam:Ank_2 1 56 8.9e-11 PFAM
Pfam:Ank_5 18 56 1.8e-6 PFAM
Pfam:Ank 30 55 3e-5 PFAM
Pfam:Ank_3 30 55 2.7e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156067
AA Change: A144V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115525
Gene: ENSMUSG00000047909
AA Change: A144V

DomainStartEndE-ValueType
ANK 36 66 1.15e0 SMART
ANK 70 99 7.95e-4 SMART
ANK 103 132 1.59e-3 SMART
ANK 136 165 9.46e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Ankrd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01663:Ankrd16 APN 2 11778662 missense probably damaging 1.00
R0280:Ankrd16 UTSW 2 11781501 missense probably damaging 1.00
R0521:Ankrd16 UTSW 2 11789881 missense probably benign
R1441:Ankrd16 UTSW 2 11778746 missense probably damaging 1.00
R1699:Ankrd16 UTSW 2 11784393 missense probably benign
R1858:Ankrd16 UTSW 2 11778596 missense probably benign
R1944:Ankrd16 UTSW 2 11783632 splice site probably null
R2074:Ankrd16 UTSW 2 11789748 missense possibly damaging 0.82
R2104:Ankrd16 UTSW 2 11779900 intron probably benign
R2131:Ankrd16 UTSW 2 11783695 missense probably damaging 1.00
R3847:Ankrd16 UTSW 2 11789808 missense probably benign 0.04
R3940:Ankrd16 UTSW 2 11784381 missense probably benign
R4424:Ankrd16 UTSW 2 11784404 missense possibly damaging 0.95
R4707:Ankrd16 UTSW 2 11778797 missense probably damaging 1.00
R4863:Ankrd16 UTSW 2 11784316 missense probably benign 0.05
R5026:Ankrd16 UTSW 2 11789881 missense probably benign 0.05
R5079:Ankrd16 UTSW 2 11778899 missense probably damaging 1.00
R5251:Ankrd16 UTSW 2 11778741 missense probably damaging 1.00
R5304:Ankrd16 UTSW 2 11789734 missense probably benign
R5746:Ankrd16 UTSW 2 11784367 missense probably damaging 0.99
R6932:Ankrd16 UTSW 2 11786243 missense possibly damaging 0.90
R9228:Ankrd16 UTSW 2 11781507 missense probably benign 0.00
R9259:Ankrd16 UTSW 2 11779721 missense probably damaging 0.98
Z1088:Ankrd16 UTSW 2 11779818 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAAGGTTTGGCTTCTTCCAAG -3'
(R):5'- AGATGCTCTGATGCCTTGTC -3'

Sequencing Primer
(F):5'- GGCTTCTTCCAAGTGCCTCAG -3'
(R):5'- CCTGCAGGGAACTTGAACTAC -3'
Posted On 2018-11-28