Incidental Mutation 'R6958:Olfr1151'
ID541568
Institutional Source Beutler Lab
Gene Symbol Olfr1151
Ensembl Gene ENSMUSG00000047039
Gene Nameolfactory receptor 1151
SynonymsMOR177-9, GA_x6K02T2Q125-49358694-49359620
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87855862-87859923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87857951 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 259 (Y259H)
Ref Sequence ENSEMBL: ENSMUSP00000151107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061081] [ENSMUST00000217376]
Predicted Effect probably damaging
Transcript: ENSMUST00000061081
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055394
Gene: ENSMUSG00000047039
AA Change: Y259H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.6e-45 PFAM
Pfam:7tm_1 41 290 1.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217376
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Olfr1151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Olfr1151 APN 2 87857510 missense possibly damaging 0.60
IGL02314:Olfr1151 APN 2 87858056 missense probably damaging 1.00
R0127:Olfr1151 UTSW 2 87857483 missense probably benign
R0233:Olfr1151 UTSW 2 87857752 missense probably benign 0.19
R0233:Olfr1151 UTSW 2 87857752 missense probably benign 0.19
R0398:Olfr1151 UTSW 2 87858057 missense probably damaging 1.00
R1079:Olfr1151 UTSW 2 87857355 missense probably damaging 1.00
R1598:Olfr1151 UTSW 2 87857751 missense probably benign 0.01
R1965:Olfr1151 UTSW 2 87857415 missense probably benign 0.44
R3409:Olfr1151 UTSW 2 87857661 nonsense probably null
R4824:Olfr1151 UTSW 2 87857277 missense probably benign 0.24
R4962:Olfr1151 UTSW 2 87857288 missense probably benign 0.02
R4986:Olfr1151 UTSW 2 87857514 missense probably damaging 0.97
R5324:Olfr1151 UTSW 2 87857696 missense probably damaging 1.00
R5934:Olfr1151 UTSW 2 87857241 missense probably benign
R6335:Olfr1151 UTSW 2 87857467 nonsense probably null
R6389:Olfr1151 UTSW 2 87858023 missense probably damaging 1.00
R7329:Olfr1151 UTSW 2 87857241 missense probably benign
R8228:Olfr1151 UTSW 2 87857940 missense probably benign 0.12
R8506:Olfr1151 UTSW 2 87857837 missense probably damaging 1.00
Z1177:Olfr1151 UTSW 2 87857424 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCTGCTCTGAAATACAAGTCAATG -3'
(R):5'- GACACTTTAGAACCATGTGTGC -3'

Sequencing Primer
(F):5'- CTGAAATACAAGTCAATGAACTTGCC -3'
(R):5'- AGTGTTTGAAGAGACACATTTTACC -3'
Posted On2018-11-28