Incidental Mutation 'R6958:Lrit1'
ID541602
Institutional Source Beutler Lab
Gene Symbol Lrit1
Ensembl Gene ENSMUSG00000041044
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 1
SynonymsLrrc21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6958 (G1)
Quality Score219.009
Status Not validated
Chromosome14
Chromosomal Location37054830-37064946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 37060095 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 242 (V242L)
Ref Sequence ENSEMBL: ENSMUSP00000113964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120052]
Predicted Effect probably damaging
Transcript: ENSMUST00000120052
AA Change: V242L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113964
Gene: ENSMUSG00000041044
AA Change: V242L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 22 63 1.97e-3 SMART
LRR 82 105 1.03e1 SMART
LRR 106 129 3e1 SMART
LRR 130 152 1.12e1 SMART
LRR_TYP 154 177 4.47e-3 SMART
LRRCT 201 253 2.04e-7 SMART
IGc2 267 336 6.55e-8 SMART
FN3 429 506 2.22e0 SMART
transmembrane domain 531 553 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
Meta Mutation Damage Score 0.1859 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic communication of cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Lrit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Lrit1 APN 14 37060155 missense probably damaging 0.98
IGL01676:Lrit1 APN 14 37057437 missense probably damaging 1.00
IGL02011:Lrit1 APN 14 37062323 missense probably damaging 1.00
PIT4142001:Lrit1 UTSW 14 37062041 missense probably damaging 1.00
R0194:Lrit1 UTSW 14 37061720 missense probably damaging 1.00
R0348:Lrit1 UTSW 14 37060225 missense probably damaging 1.00
R1444:Lrit1 UTSW 14 37061971 missense probably benign
R1500:Lrit1 UTSW 14 37062134 missense probably benign 0.23
R1884:Lrit1 UTSW 14 37061753 missense possibly damaging 0.94
R2880:Lrit1 UTSW 14 37057437 missense probably damaging 1.00
R4784:Lrit1 UTSW 14 37062236 missense possibly damaging 0.79
R4855:Lrit1 UTSW 14 37061816 missense possibly damaging 0.75
R5100:Lrit1 UTSW 14 37062214 missense possibly damaging 0.74
R5365:Lrit1 UTSW 14 37062142 missense probably benign 0.00
R5474:Lrit1 UTSW 14 37061986 missense probably benign
R5475:Lrit1 UTSW 14 37055001 missense probably benign 0.00
R5614:Lrit1 UTSW 14 37061954 missense probably benign 0.39
R5688:Lrit1 UTSW 14 37062428 missense possibly damaging 0.66
R5926:Lrit1 UTSW 14 37055009 missense probably damaging 1.00
R6063:Lrit1 UTSW 14 37054988 missense probably benign 0.05
R6920:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6940:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6941:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6943:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6945:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6957:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6959:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6960:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6962:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTCCCAGAGGAGAAATGGAG -3'
(R):5'- CCACTTGGTTGCTCACACAC -3'

Sequencing Primer
(F):5'- CTGGTTCTGAAGATCTGAGGTTAACC -3'
(R):5'- ACACCTGTGCCATTGAGTG -3'
Posted On2018-11-28