Incidental Mutation 'R6958:Spata13'
ID541604
Institutional Source Beutler Lab
Gene Symbol Spata13
Ensembl Gene ENSMUSG00000021990
Gene Namespermatogenesis associated 13
SynonymsESTM11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6958 (G1)
Quality Score205.009
Status Not validated
Chromosome14
Chromosomal Location60634001-60764556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60751851 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 319 (T319S)
Ref Sequence ENSEMBL: ENSMUSP00000123888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022566] [ENSMUST00000160973] [ENSMUST00000162945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022566
AA Change: T989S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022566
Gene: ENSMUSG00000021990
AA Change: T989S

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160973
AA Change: T989S

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123928
Gene: ENSMUSG00000021990
AA Change: T989S

DomainStartEndE-ValueType
low complexity region 307 320 N/A INTRINSIC
low complexity region 354 370 N/A INTRINSIC
low complexity region 426 450 N/A INTRINSIC
low complexity region 453 462 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 571 584 N/A INTRINSIC
low complexity region 604 623 N/A INTRINSIC
SH3 742 797 4.92e-16 SMART
RhoGEF 836 1015 1.22e-58 SMART
PH 1048 1155 1.16e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162131
SMART Domains Protein: ENSMUSP00000124586
Gene: ENSMUSG00000021990

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
SH3 208 263 4.92e-16 SMART
Blast:RhoGEF 302 340 7e-19 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000162945
AA Change: T319S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123888
Gene: ENSMUSG00000021990
AA Change: T319S

DomainStartEndE-ValueType
SH3 72 127 4.92e-16 SMART
RhoGEF 166 345 1.22e-58 SMART
PH 378 485 1.16e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal but show a significant reduction in the number and size of intestinal adenomas in conjunction with ApcMin heterozygotes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Zfp641 C T 15: 98,292,951 V71I possibly damaging Het
Other mutations in Spata13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Spata13 APN 14 60691274 missense probably damaging 1.00
IGL02455:Spata13 APN 14 60706714 missense probably benign 0.01
IGL03189:Spata13 APN 14 60691614 missense possibly damaging 0.71
IGL03235:Spata13 APN 14 60751792 missense probably damaging 1.00
PIT4378001:Spata13 UTSW 14 60749996 missense probably damaging 1.00
R0278:Spata13 UTSW 14 60692088 missense probably benign 0.02
R0316:Spata13 UTSW 14 60692339 missense probably benign
R0458:Spata13 UTSW 14 60692043 missense probably damaging 0.98
R1546:Spata13 UTSW 14 60756408 missense probably damaging 1.00
R1780:Spata13 UTSW 14 60691725 missense probably damaging 0.96
R1791:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R1970:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R2059:Spata13 UTSW 14 60759591 missense possibly damaging 0.79
R2063:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2068:Spata13 UTSW 14 60760871 critical splice acceptor site probably benign
R2212:Spata13 UTSW 14 60706723 missense probably benign 0.00
R2327:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R3414:Spata13 UTSW 14 60706723 missense probably benign 0.00
R4115:Spata13 UTSW 14 60692478 missense probably damaging 1.00
R4276:Spata13 UTSW 14 60756296 missense probably damaging 1.00
R4289:Spata13 UTSW 14 60691074 missense probably damaging 1.00
R4291:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4293:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4294:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4295:Spata13 UTSW 14 60709555 missense probably damaging 0.98
R4779:Spata13 UTSW 14 60753907 nonsense probably null
R4780:Spata13 UTSW 14 60753907 nonsense probably null
R4838:Spata13 UTSW 14 60733179 missense probably benign 0.17
R4997:Spata13 UTSW 14 60709459 missense probably damaging 1.00
R5066:Spata13 UTSW 14 60750089 missense possibly damaging 0.78
R5399:Spata13 UTSW 14 60747541 missense probably benign 0.00
R5685:Spata13 UTSW 14 60691203 missense probably benign 0.00
R5708:Spata13 UTSW 14 60692003 missense probably damaging 1.00
R5747:Spata13 UTSW 14 60747503 missense probably benign 0.00
R6073:Spata13 UTSW 14 60750021 missense probably damaging 1.00
R6135:Spata13 UTSW 14 60756428 missense probably damaging 0.98
R6233:Spata13 UTSW 14 60692007 missense probably benign 0.06
R6782:Spata13 UTSW 14 60691463 missense probably damaging 0.99
R6873:Spata13 UTSW 14 60691957 missense probably benign
R7105:Spata13 UTSW 14 60753870 missense probably damaging 0.97
R7286:Spata13 UTSW 14 60756422 missense probably damaging 1.00
R7512:Spata13 UTSW 14 60751777 missense probably damaging 1.00
R7565:Spata13 UTSW 14 60751849 missense probably damaging 1.00
R7608:Spata13 UTSW 14 60692507 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CGCCATCTACTCTGAGTACTGC -3'
(R):5'- TGCTGCCACATTACCATCAC -3'

Sequencing Primer
(F):5'- TCTACTCTGAGTACTGCAACAAC -3'
(R):5'- GCCACATTACCATCACCACCAG -3'
Posted On2018-11-28