Incidental Mutation 'R6958:Zfp641'
ID541608
Institutional Source Beutler Lab
Gene Symbol Zfp641
Ensembl Gene ENSMUSG00000022987
Gene Namezinc finger protein 641
Synonyms9930016F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6958 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location98285585-98296161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98292951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 71 (V71I)
Ref Sequence ENSEMBL: ENSMUSP00000023722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023722] [ENSMUST00000169721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023722
AA Change: V71I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023722
Gene: ENSMUSG00000022987
AA Change: V71I

DomainStartEndE-ValueType
KRAB 91 142 2.16e-10 SMART
ZnF_C2H2 236 258 1.58e-3 SMART
ZnF_C2H2 264 286 1.67e-2 SMART
ZnF_C2H2 292 314 1.33e-1 SMART
ZnF_C2H2 342 364 8.94e-3 SMART
ZnF_C2H2 370 392 3.83e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169721
AA Change: V71I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133212
Gene: ENSMUSG00000022987
AA Change: V71I

DomainStartEndE-ValueType
low complexity region 83 89 N/A INTRINSIC
KRAB 95 156 2.56e-21 SMART
ZnF_C2H2 250 272 1.58e-3 SMART
ZnF_C2H2 278 300 1.67e-2 SMART
ZnF_C2H2 306 328 1.33e-1 SMART
ZnF_C2H2 356 378 8.94e-3 SMART
ZnF_C2H2 384 406 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 96.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,943,803 D159G probably benign Het
Ahnak A G 19: 9,015,215 N4621S possibly damaging Het
Ankrd16 C T 2: 11,779,793 A144V probably damaging Het
BC080695 A T 4: 143,571,259 D83V probably damaging Het
Ccdc14 T C 16: 34,690,806 V2A probably damaging Het
Ccdc187 C T 2: 26,289,719 V243I probably benign Het
Cdk12 A T 11: 98,241,699 I985F unknown Het
Cfap65 T C 1: 74,931,899 T87A possibly damaging Het
Cilp2 G A 8: 69,882,540 P603S probably benign Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cpa6 C T 1: 10,595,688 V42M probably damaging Het
Cpsf4 A G 5: 145,175,592 I115V probably benign Het
Dnah11 G T 12: 117,933,809 P3562Q probably damaging Het
Dnah9 A G 11: 66,076,341 F1664L probably damaging Het
Dpysl3 T C 18: 43,438,002 Q69R probably benign Het
Dusp27 T A 1: 166,107,996 D211V probably damaging Het
Ebf3 T C 7: 137,199,265 T455A possibly damaging Het
Eif2ak3 T A 6: 70,892,683 C785S probably benign Het
Elk4 T A 1: 132,017,832 F149L probably damaging Het
Fgf14 A G 14: 124,676,597 W41R probably benign Het
Fmnl1 T A 11: 103,171,314 M1K probably null Het
Foxk2 A T 11: 121,299,737 Q568L probably benign Het
Fryl T G 5: 73,073,929 I1602L possibly damaging Het
Gfm2 A G 13: 97,146,236 I75V probably damaging Het
Gm3233 T A 10: 77,759,535 probably benign Het
Gm5096 G A 18: 87,756,922 E190K probably benign Het
Gnb1 G T 4: 155,543,194 probably null Het
Gphn G T 12: 78,680,299 V662L possibly damaging Het
Il3 A C 11: 54,267,111 V47G probably benign Het
Iqgap3 A G 3: 88,113,366 D401G possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Krtap6-2 A G 16: 89,419,810 S90P unknown Het
Lars C T 18: 42,236,639 V394I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Lrp10 A G 14: 54,469,821 probably benign Het
Ltn1 A T 16: 87,397,791 C1407S probably benign Het
Lzts2 G T 19: 45,024,143 probably benign Het
Msantd2 A G 9: 37,523,457 E331G probably damaging Het
Myo15 G A 11: 60,503,625 G1218S probably benign Het
Myom2 G A 8: 15,117,741 A1109T probably null Het
Nhp2 A G 11: 51,623,107 T118A probably benign Het
Nup155 A G 15: 8,147,154 Y972C probably damaging Het
Nxpe2 A T 9: 48,326,266 C230S probably damaging Het
Olfr103 T C 17: 37,336,417 I272V probably benign Het
Olfr1151 T C 2: 87,857,951 Y259H probably damaging Het
Olfr577 A G 7: 102,973,884 L36P possibly damaging Het
Pfkfb4 A T 9: 109,010,547 N244I probably damaging Het
Pi4ka C T 16: 17,325,227 R24Q probably damaging Het
Pkd2l2 C A 18: 34,409,490 Y8* probably null Het
Ptprb T A 10: 116,277,248 N44K probably benign Het
Sds G A 5: 120,481,472 V149M probably damaging Het
Slc22a30 A G 19: 8,386,701 F204L probably damaging Het
Slc26a7 C T 4: 14,506,442 A636T probably benign Het
Slc27a1 C T 8: 71,585,439 A577V possibly damaging Het
Spata13 A T 14: 60,751,851 T319S possibly damaging Het
Tdrd3 A G 14: 87,457,096 D29G probably damaging Het
Tex15 A T 8: 33,570,871 I110L probably benign Het
Treml2 A G 17: 48,308,152 T222A probably damaging Het
Trpd52l3 A T 19: 30,004,146 L100F probably damaging Het
Ttf2 C T 3: 100,945,932 E975K probably benign Het
Vmn1r193 T A 13: 22,219,974 probably benign Het
Xpo1 A G 11: 23,285,855 T648A probably benign Het
Other mutations in Zfp641
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Zfp641 APN 15 98291185 missense possibly damaging 0.85
IGL03092:Zfp641 APN 15 98290516 missense probably damaging 1.00
IGL03191:Zfp641 APN 15 98288687 missense probably damaging 0.98
R0079:Zfp641 UTSW 15 98289089 missense probably benign 0.28
R0243:Zfp641 UTSW 15 98289127 missense possibly damaging 0.82
R0487:Zfp641 UTSW 15 98289179 missense probably benign
R2092:Zfp641 UTSW 15 98293712 missense probably benign
R3415:Zfp641 UTSW 15 98290540 missense probably benign 0.28
R4834:Zfp641 UTSW 15 98293704 missense probably damaging 1.00
R4851:Zfp641 UTSW 15 98288717 missense probably damaging 0.99
R5776:Zfp641 UTSW 15 98289010 missense probably damaging 1.00
R6057:Zfp641 UTSW 15 98292935 missense probably benign 0.00
R6896:Zfp641 UTSW 15 98293803 start codon destroyed probably benign 0.06
R6969:Zfp641 UTSW 15 98290567 missense possibly damaging 0.46
R8117:Zfp641 UTSW 15 98288975 missense probably damaging 1.00
R8314:Zfp641 UTSW 15 98290583 missense probably damaging 0.97
Z1177:Zfp641 UTSW 15 98288535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGGTTATTCTGAAATCACCAC -3'
(R):5'- ACTGTTTGAGTGGAGGCCTC -3'

Sequencing Primer
(F):5'- GAATCTATTCCGTTCTAAGCACAC -3'
(R):5'- TCCTGGGAAAGATGGGTA -3'
Posted On2018-11-28