Incidental Mutation 'R6959:Kcne4'
ID 541625
Institutional Source Beutler Lab
Gene Symbol Kcne4
Ensembl Gene ENSMUSG00000047330
Gene Name potassium voltage-gated channel, Isk-related subfamily, gene 4
Synonyms MiRP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 78816758-78820028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78817886 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 84 (M84V)
Ref Sequence ENSEMBL: ENSMUSP00000055415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057262] [ENSMUST00000187432]
AlphaFold Q9WTW3
Predicted Effect probably benign
Transcript: ENSMUST00000057262
AA Change: M84V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055415
Gene: ENSMUSG00000047330
AA Change: M84V

DomainStartEndE-ValueType
Pfam:ISK_Channel 4 86 2.3e-11 PFAM
low complexity region 124 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187432
SMART Domains Protein: ENSMUSP00000140235
Gene: ENSMUSG00000047330

DomainStartEndE-ValueType
Pfam:ISK_Channel 6 64 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the embryo and in adult uterus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Kcne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Kcne4 APN 1 78817808 missense possibly damaging 0.89
IGL03047:Kcne4 UTSW 1 78817778 missense possibly damaging 0.64
R2091:Kcne4 UTSW 1 78817907 missense probably benign 0.00
R2426:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R3405:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R3406:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R4158:Kcne4 UTSW 1 78818102 missense probably benign 0.01
R4159:Kcne4 UTSW 1 78818102 missense probably benign 0.01
R4414:Kcne4 UTSW 1 78817934 missense probably benign
R8461:Kcne4 UTSW 1 78817716 missense probably benign 0.26
R9020:Kcne4 UTSW 1 78817708 missense probably benign 0.00
R9311:Kcne4 UTSW 1 78818107 missense probably benign
R9375:Kcne4 UTSW 1 78817906 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAGTGGTAATGGCAATG -3'
(R):5'- AGCCTTCACTGCTGTCGTTG -3'

Sequencing Primer
(F):5'- GCAGTGGTAATGGCAATGAATACTTC -3'
(R):5'- CACTGCTGTCGTTGAGAGGC -3'
Posted On 2018-11-28