Mutagenetix > Incidental Mutations

Incidental Mutation 'R6959:Cntnap5b'

541626

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5b

Ensembl Gene

ENSMUSG00000067028

Gene Name

contactin associated protein-like 5B

Synonyms

Caspr5-2, C230078M14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R6959 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99772765-100485942 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100274472 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 348 (E348G)

Ref Sequence

ENSEMBL: ENSMUSP00000139877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]

AlphaFold

Q0V8T8

Predicted Effect

probably benign
Transcript: ENSMUST00000086738
AA Change: E662G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: E662G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	39	174	2.76e-16	SMART
LamG	201	338	2.84e-27	SMART
LamG	387	521	9.22e-27	SMART
EGF	549	583	1.14e0	SMART
Blast:FBG	586	758	3e-66	BLAST
LamG	798	925	2.12e-26	SMART
EGF	946	982	1.51e0	SMART
LamG	1023	1159	2.14e-13	SMART
transmembrane domain	1227	1249	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188735
AA Change: E348G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: E348G

Domain	Start	End	E-Value	Type
LamG	73	207	5.9e-29	SMART
EGF	235	269	5.6e-3	SMART
Blast:FBG	272	402	2e-42	BLAST
LamG	415	554	2.5e-11	SMART
EGF	575	611	7.1e-3	SMART
LamG	652	788	1.4e-15	SMART
transmembrane domain	856	878	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

94% (61/65)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	G	A	11: 70,616,659	G177R	probably damaging	Het
4932438A13Rik	T	G	3: 36,967,189	V2154G	probably damaging	Het
Arhgef12	T	C	9: 43,015,953	T292A	probably benign	Het
Atp11a	T	A	8: 12,820,467	D173E	probably damaging	Het
Btnl2	G	A	17: 34,363,359	V300M	possibly damaging	Het
Calcrl	A	T	2: 84,370,084	N117K	possibly damaging	Het
Ccl22	A	T	8: 94,746,900		probably null	Het
Cd200r1	T	A	16: 44,790,176	S216T	probably damaging	Het
Cdk5rap2	G	A	4: 70,360,669		probably null	Het
Cfap157	A	G	2: 32,784,248	I47T	probably damaging	Het
Chodl	G	A	16: 78,946,684	V220I	probably damaging	Het
Cstf3	A	G	2: 104,649,462	T225A	probably benign	Het
Duoxa1	T	C	2: 122,303,837	S267G	probably damaging	Het
Epb41l1	G	A	2: 156,499,587	S164N	probably benign	Het
Fam126a	T	C	5: 23,991,756	I45V	possibly damaging	Het
Fat3	T	C	9: 15,996,885	D2607G	possibly damaging	Het
Galnt5	A	G	2: 57,999,219	D277G	probably benign	Het
Galnt6	A	G	15: 100,714,125	I212T	probably damaging	Het
Gatsl2	T	C	5: 134,135,213	S83P	probably damaging	Het
Gm45861	T	C	8: 27,548,185		probably null	Het
Gm5478	T	C	15: 101,645,448	D243G	probably damaging	Het
Gm6657	A	G	12: 78,202,296	K139E	probably damaging	Het
Gm7682	T	A	5: 94,447,032	N250K	possibly damaging	Het
Gse1	A	G	8: 120,570,971		probably benign	Het
Hspg2	A	T	4: 137,519,289	Q1096L	probably benign	Het
Idh3b	A	G	2: 130,281,527	V181A	probably damaging	Het
Igf2bp3	T	C	6: 49,117,148		probably null	Het
Ikzf2	A	G	1: 69,538,770	*382Q	probably null	Het
Impg2	A	C	16: 56,268,330	H1073P	probably benign	Het
Incenp	T	C	19: 9,876,770	E639G	unknown	Het
Kcne4	A	G	1: 78,817,886	M84V	probably benign	Het
Ktn1	T	A	14: 47,720,256	F1004I	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Malrd1	A	G	2: 16,218,009	I2040V	probably damaging	Het
Mau2	T	C	8: 70,033,228	D110G	probably damaging	Het
Mei1	T	C	15: 82,124,875	V1237A	probably benign	Het
Mfsd11	T	G	11: 116,861,669		probably null	Het
Ncapd2	A	G	6: 125,168,920	F1293L	probably benign	Het
Nf1	A	G	11: 79,549,468	T280A	probably damaging	Het
Obscn	G	T	11: 59,037,585	A6085E	probably damaging	Het
Olfr623	T	A	7: 103,660,843	I136F	probably damaging	Het
Pdzd2	C	T	15: 12,375,907	A1381T	probably benign	Het
Ralgapa2	A	G	2: 146,342,701	V1462A	probably damaging	Het
Rbx1	T	A	15: 81,470,962	C56*	probably null	Het
Reln	A	G	5: 21,976,564	S1774P	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sarnp	T	C	10: 128,848,268	V111A	possibly damaging	Het
Scube1	G	T	15: 83,629,435	Q345K	probably benign	Het
Slc18b1	A	G	10: 23,826,044		probably null	Het
Slc37a2	T	A	9: 37,241,334	T64S	probably benign	Het
Slit2	A	G	5: 48,238,385	D710G	possibly damaging	Het
Srp72	T	A	5: 76,994,223	Y375N	possibly damaging	Het
Tmco4	T	A	4: 139,010,499	V135D	probably damaging	Het
Trim62	A	G	4: 128,909,162	D335G	probably damaging	Het
Tsfm	T	C	10: 127,022,909	M196V	probably benign	Het
Tspan10	T	A	11: 120,444,696	C211S	probably damaging	Het
Ttc21b	A	T	2: 66,231,312	M498K	probably benign	Het
Ttc6	A	T	12: 57,658,142		probably null	Het
Ttll1	G	T	15: 83,502,196	Y69*	probably null	Het
Usp28	T	A	9: 49,001,542	L31H	probably damaging	Het
Vmn2r86	A	G	10: 130,446,531	S739P	probably damaging	Het
Wdr64	T	A	1: 175,705,989	F64I	probably damaging	Het
Ywhaq	A	G	12: 21,396,280		probably null	Het
Zfr	T	C	15: 12,150,323	S459P	probably damaging	Het

Other mutations in Cntnap5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Cntnap5b	APN	1	100050754	missense	probably damaging	1.00
IGL00477:Cntnap5b	APN	1	100213743	missense	probably damaging	0.97
IGL00505:Cntnap5b	APN	1	100379161	missense	possibly damaging	0.81
IGL00596:Cntnap5b	APN	1	100379161	missense	possibly damaging	0.81
IGL00846:Cntnap5b	APN	1	100164223	missense	probably damaging	1.00
IGL00895:Cntnap5b	APN	1	100383585	missense	probably damaging	0.98
IGL00948:Cntnap5b	APN	1	100141357	missense	probably benign	0.00
IGL01073:Cntnap5b	APN	1	100076030	missense	probably benign	0.08
IGL01523:Cntnap5b	APN	1	100431779	missense	probably benign	0.02
IGL01779:Cntnap5b	APN	1	99967339	missense	probably damaging	1.00
IGL02253:Cntnap5b	APN	1	100164211	missense	possibly damaging	0.75
IGL02628:Cntnap5b	APN	1	100072069	missense	probably damaging	0.97
R0166:Cntnap5b	UTSW	1	100274361	missense	probably benign	0.41
R0211:Cntnap5b	UTSW	1	100478374	missense	possibly damaging	0.82
R0281:Cntnap5b	UTSW	1	100072153	missense	probably benign	0.22
R0363:Cntnap5b	UTSW	1	100274468	missense	probably benign	0.01
R0514:Cntnap5b	UTSW	1	99772786	missense	probably benign
R0645:Cntnap5b	UTSW	1	100072042	splice site	probably benign
R0848:Cntnap5b	UTSW	1	100255163	missense	probably benign	0.22
R1006:Cntnap5b	UTSW	1	100383617	missense	probably benign	0.00
R1349:Cntnap5b	UTSW	1	100164088	missense	probably benign	0.09
R1372:Cntnap5b	UTSW	1	100164088	missense	probably benign	0.09
R1474:Cntnap5b	UTSW	1	100072089	missense	probably benign	0.25
R1681:Cntnap5b	UTSW	1	100076107	missense	probably damaging	0.98
R1727:Cntnap5b	UTSW	1	100213744	missense	possibly damaging	0.91
R1760:Cntnap5b	UTSW	1	99772810	missense	probably benign	0.05
R1777:Cntnap5b	UTSW	1	100370078	missense	probably benign	0.10
R1939:Cntnap5b	UTSW	1	99967348	missense	probably benign
R1988:Cntnap5b	UTSW	1	100072140	missense	possibly damaging	0.92
R2069:Cntnap5b	UTSW	1	100358725	missense	probably benign	0.04
R2113:Cntnap5b	UTSW	1	100274415	missense	probably benign
R2148:Cntnap5b	UTSW	1	100383474	missense	probably benign	0.01
R2158:Cntnap5b	UTSW	1	100390572	missense	probably damaging	1.00
R2223:Cntnap5b	UTSW	1	100213687	missense	probably damaging	1.00
R2350:Cntnap5b	UTSW	1	100379126	missense	probably damaging	1.00
R3840:Cntnap5b	UTSW	1	100383477	missense	possibly damaging	0.50
R4329:Cntnap5b	UTSW	1	100072163	missense	probably damaging	0.99
R4609:Cntnap5b	UTSW	1	99772847	critical splice donor site	probably null
R4799:Cntnap5b	UTSW	1	100358725	missense	probably benign	0.04
R5129:Cntnap5b	UTSW	1	100379090	missense	probably damaging	1.00
R5323:Cntnap5b	UTSW	1	100383550	nonsense	probably null
R5434:Cntnap5b	UTSW	1	100072201	missense	probably benign	0.02
R5579:Cntnap5b	UTSW	1	100383395	nonsense	probably null
R5579:Cntnap5b	UTSW	1	100383399	missense	probably benign	0.27
R5630:Cntnap5b	UTSW	1	100072069	missense	probably damaging	0.99
R5644:Cntnap5b	UTSW	1	100383601	missense	probably benign	0.00
R5761:Cntnap5b	UTSW	1	100446894	missense	probably damaging	1.00
R6042:Cntnap5b	UTSW	1	100390592	missense	probably benign
R6147:Cntnap5b	UTSW	1	100050781	missense	probably damaging	1.00
R6190:Cntnap5b	UTSW	1	100379075	missense	possibly damaging	0.80
R6248:Cntnap5b	UTSW	1	100072102	missense	probably benign	0.30
R6286:Cntnap5b	UTSW	1	100255073	missense	possibly damaging	0.82
R6306:Cntnap5b	UTSW	1	100164146	missense	probably damaging	1.00
R6336:Cntnap5b	UTSW	1	100358669	missense	probably benign	0.00
R6360:Cntnap5b	UTSW	1	100431736	nonsense	probably null
R6722:Cntnap5b	UTSW	1	100478486	missense	probably damaging	0.98
R6750:Cntnap5b	UTSW	1	100274499	missense	probably damaging	1.00
R6806:Cntnap5b	UTSW	1	99940649	missense	probably damaging	1.00
R6933:Cntnap5b	UTSW	1	100383450	missense	probably benign	0.01
R6957:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6958:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6961:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R6962:Cntnap5b	UTSW	1	100274472	missense	probably benign	0.08
R7088:Cntnap5b	UTSW	1	100160077	missense	probably damaging	0.99
R7146:Cntnap5b	UTSW	1	100050794	splice site	probably null
R7165:Cntnap5b	UTSW	1	100076162	missense	possibly damaging	0.94
R7190:Cntnap5b	UTSW	1	100431849	splice site	probably null
R7376:Cntnap5b	UTSW	1	99967269	missense	possibly damaging	0.92
R7385:Cntnap5b	UTSW	1	100379090	missense	probably damaging	1.00
R8053:Cntnap5b	UTSW	1	100390677	missense	probably damaging	0.98
R8080:Cntnap5b	UTSW	1	100072203	missense	probably benign	0.16
R8082:Cntnap5b	UTSW	1	100379216	missense	probably benign	0.00
R8271:Cntnap5b	UTSW	1	100072107	missense	probably benign	0.00
R8303:Cntnap5b	UTSW	1	100141297	missense	probably damaging	1.00
R8428:Cntnap5b	UTSW	1	100383585	missense	probably damaging	0.98
R9131:Cntnap5b	UTSW	1	100050643	missense	probably benign	0.22
R9144:Cntnap5b	UTSW	1	100050787	missense	probably damaging	1.00
RF007:Cntnap5b	UTSW	1	100164070	missense	probably damaging	1.00
X0020:Cntnap5b	UTSW	1	100431848	critical splice donor site	probably null
Z1176:Cntnap5b	UTSW	1	99967270	missense	probably damaging	0.99
Z1176:Cntnap5b	UTSW	1	100164228	missense	possibly damaging	0.86
Z1176:Cntnap5b	UTSW	1	100446840	missense	probably benign	0.01
Z1177:Cntnap5b	UTSW	1	100050706	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ACTGCTTTGTCCTTTGAGTGAC -3'
(R):5'- GAAAGAGCATTGTGACCCAC -3'

Sequencing Primer
(F):5'- AGTGACTCATGTTTATGTACTCTTGC -3'
(R):5'- GAGCACTCCACATCAGTCTTGGAG -3'

Posted On

2018-11-28