Incidental Mutation 'R6959:Cfap157'
ID541629
Institutional Source Beutler Lab
Gene Symbol Cfap157
Ensembl Gene ENSMUSG00000038987
Gene Namecilia and flagella associated protein 157
Synonyms1700019L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6959 (G1)
Quality Score189.009
Status Validated
Chromosome2
Chromosomal Location32777381-32784428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32784248 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 47 (I47T)
Ref Sequence ENSEMBL: ENSMUSP00000099877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458] [ENSMUST00000102813]
Predicted Effect probably benign
Transcript: ENSMUST00000050000
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077458
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102813
AA Change: I47T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099877
Gene: ENSMUSG00000038987
AA Change: I47T

DomainStartEndE-ValueType
coiled coil region 32 191 N/A INTRINSIC
coiled coil region 301 371 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype PHENOTYPE: Homozygous knockout males are infertile owing to reduced sperm count and reduced and abnormal sperm motility as a result of abnormal sperm morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Cfap157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cfap157 APN 2 32781383 missense probably damaging 1.00
IGL00852:Cfap157 APN 2 32779815 missense possibly damaging 0.89
IGL01284:Cfap157 APN 2 32781479 missense possibly damaging 0.69
IGL02315:Cfap157 APN 2 32778165 missense probably benign 0.02
PIT4810001:Cfap157 UTSW 2 32781432 missense probably damaging 0.96
R0654:Cfap157 UTSW 2 32779942 missense probably damaging 1.00
R0699:Cfap157 UTSW 2 32779010 missense probably damaging 1.00
R1103:Cfap157 UTSW 2 32781398 missense probably damaging 1.00
R1123:Cfap157 UTSW 2 32777923 missense possibly damaging 0.93
R2165:Cfap157 UTSW 2 32778163 unclassified probably null
R4304:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4307:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4308:Cfap157 UTSW 2 32779042 missense probably damaging 1.00
R4439:Cfap157 UTSW 2 32777865 missense probably benign 0.00
R4859:Cfap157 UTSW 2 32777542 missense probably benign 0.00
R4880:Cfap157 UTSW 2 32778249 missense probably damaging 1.00
R4917:Cfap157 UTSW 2 32779953 missense probably benign 0.19
R5808:Cfap157 UTSW 2 32780645 missense probably damaging 1.00
R6052:Cfap157 UTSW 2 32779851 missense probably damaging 1.00
R6405:Cfap157 UTSW 2 32781396 missense probably damaging 1.00
R6502:Cfap157 UTSW 2 32780678 missense probably damaging 1.00
R6647:Cfap157 UTSW 2 32779074 missense probably benign
R7123:Cfap157 UTSW 2 32779401 missense probably damaging 0.99
R7469:Cfap157 UTSW 2 32780684 missense probably damaging 1.00
R7527:Cfap157 UTSW 2 32779878 missense possibly damaging 0.86
R7573:Cfap157 UTSW 2 32777508 missense probably benign 0.00
R7697:Cfap157 UTSW 2 32779753 missense probably benign 0.01
X0020:Cfap157 UTSW 2 32779855 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTTACAGTGCCGTCCTGTGG -3'
(R):5'- ACTACCTGGCTTCTTAAAGGGG -3'

Sequencing Primer
(F):5'- TCCCCGAGCTCTGGGAATC -3'
(R):5'- CCATGGCTCCAAAAAAGAAG -3'
Posted On2018-11-28