Incidental Mutation 'R0606:Dnah9'
ID54163
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Namedynein, axonemal, heavy chain 9
SynonymsD11Ertd686e, Dnahc9
MMRRC Submission 038795-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0606 (G1)
Quality Score137
Status Validated
Chromosome11
Chromosomal Location65831282-66168551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65841333 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 4249 (Y4249C)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: Y4249C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: Y4249C

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152386
AA Change: Y1722C
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: Y1722C

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Meta Mutation Damage Score 0.9060 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (99/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410131K14Rik T C 5: 118,259,089 Y128H probably damaging Het
Actl9 T C 17: 33,433,598 Y211H probably damaging Het
Actn1 A T 12: 80,174,647 probably benign Het
Adtrp A G 13: 41,767,405 F197L probably damaging Het
Ankrd11 G A 8: 122,892,832 T1406I probably benign Het
Arhgap24 A T 5: 102,897,220 R620W probably damaging Het
Atg13 A G 2: 91,682,073 Y284H probably benign Het
Atrn A G 2: 130,906,856 E99G possibly damaging Het
Cage1 A T 13: 38,016,494 probably benign Het
Ccr3 T A 9: 124,028,802 M58K probably benign Het
Cdk18 G T 1: 132,117,617 probably benign Het
Chst5 A G 8: 111,890,919 V23A probably benign Het
Col4a3 T C 1: 82,672,586 probably benign Het
Col4a6 A G X: 141,192,223 probably benign Het
Csmd3 T C 15: 48,457,662 I251V probably benign Het
Csnk1g3 G A 18: 53,917,028 V115M probably damaging Het
Cst7 A T 2: 150,570,519 M1L probably benign Het
Cyp4f17 A T 17: 32,527,843 D373V probably damaging Het
Dclk2 G A 3: 86,906,004 R212W probably damaging Het
Dhrs7b T G 11: 60,830,746 probably benign Het
Dhx58 T A 11: 100,702,251 H210L probably benign Het
Eif5b T A 1: 38,048,893 L990H probably damaging Het
Faap24 T C 7: 35,394,963 probably benign Het
Fryl T A 5: 73,124,734 H174L probably benign Het
Gabrr1 T C 4: 33,132,696 W15R probably benign Het
Gif A T 19: 11,752,294 I206F possibly damaging Het
Gm15446 T C 5: 109,943,481 V533A probably benign Het
Gm6760 T A X: 64,151,653 K63* probably null Het
Gne C T 4: 44,042,244 E444K possibly damaging Het
Gpr173 T A X: 152,347,040 M146L possibly damaging Het
Hira C T 16: 18,935,047 S547L probably benign Het
Hnf1b A G 11: 83,863,984 H161R probably benign Het
Hnrnpm T A 17: 33,658,390 N53I probably damaging Het
Hs3st5 A T 10: 36,832,588 I40F probably benign Het
Hydin C T 8: 110,549,798 probably benign Het
Ift172 A G 5: 31,254,313 I1607T probably damaging Het
Igfn1 T C 1: 135,959,901 Q2475R probably damaging Het
Il6st T C 13: 112,504,272 S800P possibly damaging Het
Iqub G A 6: 24,501,261 probably benign Het
Itgb1 A T 8: 128,722,372 probably benign Het
Kctd21 G A 7: 97,347,601 E94K probably benign Het
Kir3dl2 A G X: 136,453,511 V233A possibly damaging Het
Klra2 A T 6: 131,220,224 C271S probably damaging Het
Lacc1 A T 14: 77,029,621 C401S probably damaging Het
Lmna T C 3: 88,482,578 E580G probably damaging Het
Matn2 A G 15: 34,345,150 Y101C probably damaging Het
Mrps16 G A 14: 20,391,389 R116* probably null Het
Ndrg2 G T 14: 51,906,217 R333S probably damaging Het
Nf2 A G 11: 4,782,194 I507T possibly damaging Het
Nktr A G 9: 121,749,290 probably benign Het
Nkx3-1 G A 14: 69,191,006 probably benign Het
Npat T C 9: 53,556,481 probably null Het
Nrxn1 T C 17: 90,565,373 N1047S probably damaging Het
Nup210 A T 6: 91,026,929 I1402N possibly damaging Het
Olfr1168 G T 2: 88,185,280 M134I possibly damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdcl2 C T 5: 76,312,481 S182N probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pla2g4a A G 1: 149,840,704 F669L probably benign Het
Plekha8 A G 6: 54,629,820 K367E probably damaging Het
Pola1 A G X: 93,488,087 probably benign Het
Ppm1d C T 11: 85,345,877 T494I probably benign Het
Pramef25 T A 4: 143,949,883 Y217F probably benign Het
Prl6a1 A T 13: 27,314,194 probably benign Het
Ptprg T A 14: 12,154,131 S617R probably benign Het
R3hdm2 G A 10: 127,444,444 G45D probably damaging Het
Rev1 T A 1: 38,059,123 R780W probably null Het
Rnf139 T A 15: 58,899,827 F567Y probably damaging Het
Scarf1 T C 11: 75,514,348 V71A probably damaging Het
Shtn1 A G 19: 58,999,940 S438P probably damaging Het
Slc30a3 T A 5: 31,088,723 H221L probably benign Het
Smo A C 6: 29,753,604 I160L possibly damaging Het
Snapc5 A T 9: 64,179,300 probably benign Het
Snf8 G T 11: 96,034,973 probably benign Het
Spata31d1a T C 13: 59,702,431 S628G probably benign Het
Sphkap A T 1: 83,280,424 D199E probably damaging Het
Stxbp5l T C 16: 37,204,521 T572A possibly damaging Het
Thada C A 17: 84,416,303 V1108L possibly damaging Het
Tln1 T C 4: 43,547,756 Q735R probably benign Het
Tmem29 C T X: 150,398,364 A144T probably benign Het
Trim24 G A 6: 37,871,234 E42K probably benign Het
Trnt1 T A 6: 106,777,908 probably benign Het
Ttbk2 A T 2: 120,773,872 M215K probably damaging Het
Ttc8 C T 12: 98,943,459 probably benign Het
Ube3c A G 5: 29,590,928 Y105C probably damaging Het
Unc13c A G 9: 73,530,983 probably benign Het
Usp36 A G 11: 118,263,028 probably benign Het
Vmn2r102 T C 17: 19,678,844 S483P possibly damaging Het
Wdr95 A G 5: 149,588,130 T432A probably damaging Het
Wnk1 G T 6: 119,926,683 P2523H probably damaging Het
Xpo4 A G 14: 57,638,208 probably benign Het
Zar1 G T 5: 72,580,543 P71Q probably damaging Het
Zbtb41 T C 1: 139,423,610 Y154H probably benign Het
Zer1 G T 2: 30,104,797 probably benign Het
Zfp454 A G 11: 50,874,185 F140S probably benign Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
anarchy UTSW 11 65955248 missense probably damaging 0.99
sacco UTSW 11 66168079 missense possibly damaging 0.82
vanzetti UTSW 11 65855372 nonsense probably null
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 66005013 missense probably benign 0.44
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0496:Dnah9 UTSW 11 66075135 missense probably null 1.00
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 unclassified probably null
R0974:Dnah9 UTSW 11 66005837 unclassified probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66037637 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1929:Dnah9 UTSW 11 65976398 missense probably benign 0.05
R1969:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5541:Dnah9 UTSW 11 66145336 missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
R7021:Dnah9 UTSW 11 65981231 missense probably benign
R7161:Dnah9 UTSW 11 65855372 nonsense probably null
R7175:Dnah9 UTSW 11 66133637 missense probably benign 0.03
R7199:Dnah9 UTSW 11 66118944 missense probably benign 0.04
R7231:Dnah9 UTSW 11 65965647 missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65990476 missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65989851 missense probably benign 0.00
R7350:Dnah9 UTSW 11 66080578 missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66117407 critical splice donor site probably null
R7427:Dnah9 UTSW 11 65955219 missense probably benign
R7477:Dnah9 UTSW 11 65992731 missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65841414 missense probably benign 0.01
R7521:Dnah9 UTSW 11 65989837 missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66125215 missense probably benign 0.43
R7659:Dnah9 UTSW 11 65989780 missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66118958 missense probably damaging 1.00
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTCTGTCACTCTGTCCCTG -3'
(R):5'- GGAACCTCACCTCTATCGTACCCTCA -3'

Sequencing Primer
(F):5'- GTGGGGTCCAGCCATGTC -3'
(R):5'- gtctttacccctgttctgcc -3'
Posted On2013-07-11