Incidental Mutation 'R6959:Duoxa1'
ID 541634
Institutional Source Beutler Lab
Gene Symbol Duoxa1
Ensembl Gene ENSMUSG00000027224
Gene Name dual oxidase maturation factor 1
Synonyms Nip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 122302191-122313730 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122303837 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 267 (S267G)
Ref Sequence ENSEMBL: ENSMUSP00000106167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028653] [ENSMUST00000028656] [ENSMUST00000110537] [ENSMUST00000110538] [ENSMUST00000147788] [ENSMUST00000148417] [ENSMUST00000154412]
AlphaFold Q8VE49
Predicted Effect probably damaging
Transcript: ENSMUST00000028653
AA Change: S312G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028653
Gene: ENSMUSG00000027224
AA Change: S312G

DomainStartEndE-ValueType
Pfam:DuoxA 10 287 7.2e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028656
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110537
AA Change: S312G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106166
Gene: ENSMUSG00000027224
AA Change: S312G

DomainStartEndE-ValueType
Pfam:DuoxA 9 290 3.9e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110538
AA Change: S267G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106167
Gene: ENSMUSG00000027224
AA Change: S267G

DomainStartEndE-ValueType
Pfam:DuoxA 9 70 1.7e-23 PFAM
Pfam:DuoxA 67 245 2.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147788
SMART Domains Protein: ENSMUSP00000116280
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 134 5.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148417
SMART Domains Protein: ENSMUSP00000116963
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 210 1.2e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154412
SMART Domains Protein: ENSMUSP00000116911
Gene: ENSMUSG00000027224

DomainStartEndE-ValueType
Pfam:DuoxA 9 100 6.3e-37 PFAM
Meta Mutation Damage Score 0.1165 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual oxidases DUOX1 and DUOX2 are NADPH oxidases which are involved in hydrogen peroxide production necessary for thyroid hormonogenesis. They form a heterodimer with specific maturation factors DUOXA1 and DUOXA2, respectively, which is essential for the maturation and function of the DUOX enzyme complexes. This gene encodes the DUOX1 activator or maturation factor DUOXA1. Rat studies identified a bidirectional promoter which controls the transcription of the DUOX1 and DUOXA1 genes. This protein is cotransported to the cell surface when coexpressed with DUOX1 and is retained in the endoplasmic reticulum when expressed without DUOX1 protein. The expression of this gene or the DUOX1 gene is not suppressed by thyroglobulin (Tg), a macromolecular precursor in thyroid hormone synthesis, while the expression of the DUOX2 and DUOXA2 are significantly suppressed by the Tg. This protein is also a p53-regulated neurogenic factor involved in p53 dependent neuronal differentiation. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele of Duoxa1 and 2 exhibit severe hypothyrodism with severe postnatal growth, delayed eye opening, enlarged thyroid, enlarged adenohypophysis, respiratory distress and death at weaning when weaned at 21 days. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Duoxa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Duoxa1 APN 2 122304646 missense probably benign 0.35
Minima UTSW 2 122303837 missense probably damaging 1.00
nadir UTSW 2 122306380 splice site probably benign
perigee UTSW 2 122305191 nonsense probably null
R0675:Duoxa1 UTSW 2 122306380 splice site probably benign
R0755:Duoxa1 UTSW 2 122304680 missense probably benign 0.03
R1387:Duoxa1 UTSW 2 122303987 missense possibly damaging 0.82
R2906:Duoxa1 UTSW 2 122304674 missense probably benign 0.15
R5327:Duoxa1 UTSW 2 122303880 missense probably damaging 0.98
R5886:Duoxa1 UTSW 2 122303810 missense possibly damaging 0.82
R6514:Duoxa1 UTSW 2 122304713 missense probably benign 0.02
R6841:Duoxa1 UTSW 2 122303981 missense probably damaging 1.00
R6845:Duoxa1 UTSW 2 122305191 nonsense probably null
R7232:Duoxa1 UTSW 2 122305247 missense probably damaging 1.00
X0017:Duoxa1 UTSW 2 122304719 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCACTTCCTGGACAGTTCTG -3'
(R):5'- CTGCTCTTAGAAGATCTTGGGAGG -3'

Sequencing Primer
(F):5'- GCTGGTTTTGTGGGGCTCC -3'
(R):5'- CTTAGAAGATCTTGGGAGGACTTAC -3'
Posted On 2018-11-28