Mutagenetix > Incidental Mutations

Incidental Mutation 'R6959:Olfr623'

541649

Institutional Source

Beutler Lab

Gene Symbol

Olfr623

Ensembl Gene

ENSMUSG00000099687

Gene Name

olfactory receptor 623

Synonyms

MOR1-4, GA_x6K02T2PBJ9-6384836-6383883

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R6959 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103657697-103663698 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 103660843 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 136 (I136F)

Ref Sequence

ENSEMBL: ENSMUSP00000150141 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062144] [ENSMUST00000068531] [ENSMUST00000213840]

Predicted Effect

probably benign
Transcript: ENSMUST00000062144

SMART Domains

Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780

Domain	Start	End	E-Value	Type
Pfam:7tm_4	27	306	3.3e-138	PFAM
Pfam:7tm_1	37	288	1.8e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000068531
AA Change: I136F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070658
Gene: ENSMUSG00000099687
AA Change: I136F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	310	1.7e-112	PFAM
Pfam:7TM_GPCR_Srsx	36	299	3.1e-7	PFAM
Pfam:7tm_1	42	293	2.6e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000213840
AA Change: I136F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.3891

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

94% (61/65)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	G	A	11: 70,616,659	G177R	probably damaging	Het
4932438A13Rik	T	G	3: 36,967,189	V2154G	probably damaging	Het
Arhgef12	T	C	9: 43,015,953	T292A	probably benign	Het
Atp11a	T	A	8: 12,820,467	D173E	probably damaging	Het
Btnl2	G	A	17: 34,363,359	V300M	possibly damaging	Het
Calcrl	A	T	2: 84,370,084	N117K	possibly damaging	Het
Ccl22	A	T	8: 94,746,900		probably null	Het
Cd200r1	T	A	16: 44,790,176	S216T	probably damaging	Het
Cdk5rap2	G	A	4: 70,360,669		probably null	Het
Cfap157	A	G	2: 32,784,248	I47T	probably damaging	Het
Chodl	G	A	16: 78,946,684	V220I	probably damaging	Het
Cntnap5b	A	G	1: 100,274,472	E348G	probably benign	Het
Cstf3	A	G	2: 104,649,462	T225A	probably benign	Het
Duoxa1	T	C	2: 122,303,837	S267G	probably damaging	Het
Epb41l1	G	A	2: 156,499,587	S164N	probably benign	Het
Fam126a	T	C	5: 23,991,756	I45V	possibly damaging	Het
Fat3	T	C	9: 15,996,885	D2607G	possibly damaging	Het
Galnt5	A	G	2: 57,999,219	D277G	probably benign	Het
Galnt6	A	G	15: 100,714,125	I212T	probably damaging	Het
Gatsl2	T	C	5: 134,135,213	S83P	probably damaging	Het
Gm45861	T	C	8: 27,548,185		probably null	Het
Gm5478	T	C	15: 101,645,448	D243G	probably damaging	Het
Gm6657	A	G	12: 78,202,296	K139E	probably damaging	Het
Gm7682	T	A	5: 94,447,032	N250K	possibly damaging	Het
Gse1	A	G	8: 120,570,971		probably benign	Het
Hspg2	A	T	4: 137,519,289	Q1096L	probably benign	Het
Idh3b	A	G	2: 130,281,527	V181A	probably damaging	Het
Igf2bp3	T	C	6: 49,117,148		probably null	Het
Ikzf2	A	G	1: 69,538,770	*382Q	probably null	Het
Impg2	A	C	16: 56,268,330	H1073P	probably benign	Het
Incenp	T	C	19: 9,876,770	E639G	unknown	Het
Kcne4	A	G	1: 78,817,886	M84V	probably benign	Het
Ktn1	T	A	14: 47,720,256	F1004I	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Malrd1	A	G	2: 16,218,009	I2040V	probably damaging	Het
Mau2	T	C	8: 70,033,228	D110G	probably damaging	Het
Mei1	T	C	15: 82,124,875	V1237A	probably benign	Het
Mfsd11	T	G	11: 116,861,669		probably null	Het
Ncapd2	A	G	6: 125,168,920	F1293L	probably benign	Het
Nf1	A	G	11: 79,549,468	T280A	probably damaging	Het
Obscn	G	T	11: 59,037,585	A6085E	probably damaging	Het
Pdzd2	C	T	15: 12,375,907	A1381T	probably benign	Het
Ralgapa2	A	G	2: 146,342,701	V1462A	probably damaging	Het
Rbx1	T	A	15: 81,470,962	C56*	probably null	Het
Reln	A	G	5: 21,976,564	S1774P	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sarnp	T	C	10: 128,848,268	V111A	possibly damaging	Het
Scube1	G	T	15: 83,629,435	Q345K	probably benign	Het
Slc18b1	A	G	10: 23,826,044		probably null	Het
Slc37a2	T	A	9: 37,241,334	T64S	probably benign	Het
Slit2	A	G	5: 48,238,385	D710G	possibly damaging	Het
Srp72	T	A	5: 76,994,223	Y375N	possibly damaging	Het
Tmco4	T	A	4: 139,010,499	V135D	probably damaging	Het
Trim62	A	G	4: 128,909,162	D335G	probably damaging	Het
Tsfm	T	C	10: 127,022,909	M196V	probably benign	Het
Tspan10	T	A	11: 120,444,696	C211S	probably damaging	Het
Ttc21b	A	T	2: 66,231,312	M498K	probably benign	Het
Ttc6	A	T	12: 57,658,142		probably null	Het
Ttll1	G	T	15: 83,502,196	Y69*	probably null	Het
Usp28	T	A	9: 49,001,542	L31H	probably damaging	Het
Vmn2r86	A	G	10: 130,446,531	S739P	probably damaging	Het
Wdr64	T	A	1: 175,705,989	F64I	probably damaging	Het
Ywhaq	A	G	12: 21,396,280		probably null	Het
Zfr	T	C	15: 12,150,323	S459P	probably damaging	Het

Other mutations in Olfr623

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Olfr623	APN	7	103661067	missense	probably damaging	0.99
IGL01669:Olfr623	APN	7	103660987	missense	probably benign	0.02
IGL01731:Olfr623	APN	7	103660846	missense	probably benign	0.01
IGL02057:Olfr623	APN	7	103660653	missense	probably damaging	1.00
IGL02249:Olfr623	APN	7	103660366	missense	probably damaging	0.99
IGL02937:Olfr623	APN	7	103660905	missense	probably damaging	1.00
IGL03113:Olfr623	APN	7	103660644	missense	possibly damaging	0.90
R0413:Olfr623	UTSW	7	103660750	missense	possibly damaging	0.52
R0862:Olfr623	UTSW	7	103660528	missense	probably damaging	1.00
R1262:Olfr623	UTSW	7	103660441	missense	probably benign	0.33
R1791:Olfr623	UTSW	7	103660798	splice site	probably null
R2327:Olfr623	UTSW	7	103660572	missense	probably damaging	1.00
R2338:Olfr623	UTSW	7	103660410	missense	possibly damaging	0.90
R4521:Olfr623	UTSW	7	103660332	missense	probably benign	0.01
R4831:Olfr623	UTSW	7	103660471	missense	probably benign	0.40
R5322:Olfr623	UTSW	7	103660672	missense	possibly damaging	0.62
R6270:Olfr623	UTSW	7	103660413	missense	possibly damaging	0.48
R7157:Olfr623	UTSW	7	103660581	missense	probably damaging	1.00
R7181:Olfr623	UTSW	7	103660813	missense	probably damaging	0.99
R7570:Olfr623	UTSW	7	103660881	missense	probably damaging	1.00
X0066:Olfr623	UTSW	7	103660660	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TAGAGACGATTGAATGTGATGTCAG -3'
(R):5'- TATGCTGGCAGCTACGGATC -3'

Sequencing Primer
(F):5'- GCACAGGCTAGCTTGATGACATC -3'
(R):5'- GGATCTTGGAGTAACATTGACCACC -3'

Posted On

2018-11-28