Incidental Mutation 'R6959:Olfr623'
ID541649
Institutional Source Beutler Lab
Gene Symbol Olfr623
Ensembl Gene ENSMUSG00000099687
Gene Nameolfactory receptor 623
SynonymsMOR1-4, GA_x6K02T2PBJ9-6384836-6383883
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R6959 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103657697-103663698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103660843 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 136 (I136F)
Ref Sequence ENSEMBL: ENSMUSP00000150141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144] [ENSMUST00000068531] [ENSMUST00000213840]
Predicted Effect probably benign
Transcript: ENSMUST00000062144
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068531
AA Change: I136F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070658
Gene: ENSMUSG00000099687
AA Change: I136F

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1.7e-112 PFAM
Pfam:7TM_GPCR_Srsx 36 299 3.1e-7 PFAM
Pfam:7tm_1 42 293 2.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213840
AA Change: I136F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3891 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mau2 T C 8: 70,033,228 D110G probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Olfr623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Olfr623 APN 7 103661067 missense probably damaging 0.99
IGL01669:Olfr623 APN 7 103660987 missense probably benign 0.02
IGL01731:Olfr623 APN 7 103660846 missense probably benign 0.01
IGL02057:Olfr623 APN 7 103660653 missense probably damaging 1.00
IGL02249:Olfr623 APN 7 103660366 missense probably damaging 0.99
IGL02937:Olfr623 APN 7 103660905 missense probably damaging 1.00
IGL03113:Olfr623 APN 7 103660644 missense possibly damaging 0.90
R0413:Olfr623 UTSW 7 103660750 missense possibly damaging 0.52
R0862:Olfr623 UTSW 7 103660528 missense probably damaging 1.00
R1262:Olfr623 UTSW 7 103660441 missense probably benign 0.33
R1791:Olfr623 UTSW 7 103660798 splice site probably null
R2327:Olfr623 UTSW 7 103660572 missense probably damaging 1.00
R2338:Olfr623 UTSW 7 103660410 missense possibly damaging 0.90
R4521:Olfr623 UTSW 7 103660332 missense probably benign 0.01
R4831:Olfr623 UTSW 7 103660471 missense probably benign 0.40
R5322:Olfr623 UTSW 7 103660672 missense possibly damaging 0.62
R6270:Olfr623 UTSW 7 103660413 missense possibly damaging 0.48
R7157:Olfr623 UTSW 7 103660581 missense probably damaging 1.00
R7181:Olfr623 UTSW 7 103660813 missense probably damaging 0.99
R7570:Olfr623 UTSW 7 103660881 missense probably damaging 1.00
X0066:Olfr623 UTSW 7 103660660 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TAGAGACGATTGAATGTGATGTCAG -3'
(R):5'- TATGCTGGCAGCTACGGATC -3'

Sequencing Primer
(F):5'- GCACAGGCTAGCTTGATGACATC -3'
(R):5'- GGATCTTGGAGTAACATTGACCACC -3'
Posted On2018-11-28