Incidental Mutation 'R6959:Mau2'
ID 541652
Institutional Source Beutler Lab
Gene Symbol Mau2
Ensembl Gene ENSMUSG00000031858
Gene Name MAU2 sister chromatid cohesion factor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6959 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70016123-70042734 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70033228 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 110 (D110G)
Ref Sequence ENSEMBL: ENSMUSP00000148532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050561] [ENSMUST00000168013] [ENSMUST00000212308] [ENSMUST00000212451] [ENSMUST00000212845]
AlphaFold Q9D2X5
Predicted Effect probably damaging
Transcript: ENSMUST00000050561
AA Change: D110G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054763
Gene: ENSMUSG00000031858
AA Change: D110G

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 575 5e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168013
AA Change: D110G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131966
Gene: ENSMUSG00000031858
AA Change: D110G

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 576 8.7e-130 PFAM
Pfam:TPR_8 71 105 3.3e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212308
AA Change: D110G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212451
AA Change: D110G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000212845
AA Change: D110G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 94% (61/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik G A 11: 70,616,659 G177R probably damaging Het
4932438A13Rik T G 3: 36,967,189 V2154G probably damaging Het
Arhgef12 T C 9: 43,015,953 T292A probably benign Het
Atp11a T A 8: 12,820,467 D173E probably damaging Het
Btnl2 G A 17: 34,363,359 V300M possibly damaging Het
Calcrl A T 2: 84,370,084 N117K possibly damaging Het
Ccl22 A T 8: 94,746,900 probably null Het
Cd200r1 T A 16: 44,790,176 S216T probably damaging Het
Cdk5rap2 G A 4: 70,360,669 probably null Het
Cfap157 A G 2: 32,784,248 I47T probably damaging Het
Chodl G A 16: 78,946,684 V220I probably damaging Het
Cntnap5b A G 1: 100,274,472 E348G probably benign Het
Cstf3 A G 2: 104,649,462 T225A probably benign Het
Duoxa1 T C 2: 122,303,837 S267G probably damaging Het
Epb41l1 G A 2: 156,499,587 S164N probably benign Het
Fam126a T C 5: 23,991,756 I45V possibly damaging Het
Fat3 T C 9: 15,996,885 D2607G possibly damaging Het
Galnt5 A G 2: 57,999,219 D277G probably benign Het
Galnt6 A G 15: 100,714,125 I212T probably damaging Het
Gatsl2 T C 5: 134,135,213 S83P probably damaging Het
Gm45861 T C 8: 27,548,185 probably null Het
Gm5478 T C 15: 101,645,448 D243G probably damaging Het
Gm6657 A G 12: 78,202,296 K139E probably damaging Het
Gm7682 T A 5: 94,447,032 N250K possibly damaging Het
Gse1 A G 8: 120,570,971 probably benign Het
Hspg2 A T 4: 137,519,289 Q1096L probably benign Het
Idh3b A G 2: 130,281,527 V181A probably damaging Het
Igf2bp3 T C 6: 49,117,148 probably null Het
Ikzf2 A G 1: 69,538,770 *382Q probably null Het
Impg2 A C 16: 56,268,330 H1073P probably benign Het
Incenp T C 19: 9,876,770 E639G unknown Het
Kcne4 A G 1: 78,817,886 M84V probably benign Het
Ktn1 T A 14: 47,720,256 F1004I probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Malrd1 A G 2: 16,218,009 I2040V probably damaging Het
Mei1 T C 15: 82,124,875 V1237A probably benign Het
Mfsd11 T G 11: 116,861,669 probably null Het
Ncapd2 A G 6: 125,168,920 F1293L probably benign Het
Nf1 A G 11: 79,549,468 T280A probably damaging Het
Obscn G T 11: 59,037,585 A6085E probably damaging Het
Olfr623 T A 7: 103,660,843 I136F probably damaging Het
Pdzd2 C T 15: 12,375,907 A1381T probably benign Het
Ralgapa2 A G 2: 146,342,701 V1462A probably damaging Het
Rbx1 T A 15: 81,470,962 C56* probably null Het
Reln A G 5: 21,976,564 S1774P probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sarnp T C 10: 128,848,268 V111A possibly damaging Het
Scube1 G T 15: 83,629,435 Q345K probably benign Het
Slc18b1 A G 10: 23,826,044 probably null Het
Slc37a2 T A 9: 37,241,334 T64S probably benign Het
Slit2 A G 5: 48,238,385 D710G possibly damaging Het
Srp72 T A 5: 76,994,223 Y375N possibly damaging Het
Tmco4 T A 4: 139,010,499 V135D probably damaging Het
Trim62 A G 4: 128,909,162 D335G probably damaging Het
Tsfm T C 10: 127,022,909 M196V probably benign Het
Tspan10 T A 11: 120,444,696 C211S probably damaging Het
Ttc21b A T 2: 66,231,312 M498K probably benign Het
Ttc6 A T 12: 57,658,142 probably null Het
Ttll1 G T 15: 83,502,196 Y69* probably null Het
Usp28 T A 9: 49,001,542 L31H probably damaging Het
Vmn2r86 A G 10: 130,446,531 S739P probably damaging Het
Wdr64 T A 1: 175,705,989 F64I probably damaging Het
Ywhaq A G 12: 21,396,280 probably null Het
Zfr T C 15: 12,150,323 S459P probably damaging Het
Other mutations in Mau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Mau2 APN 8 70029245 splice site probably benign
IGL02353:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02360:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02990:Mau2 APN 8 70022255 splice site probably benign
PIT4382001:Mau2 UTSW 8 70030652 missense possibly damaging 0.95
R0378:Mau2 UTSW 8 70030655 missense probably damaging 0.99
R0556:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0558:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0731:Mau2 UTSW 8 70023612 critical splice donor site probably null
R0987:Mau2 UTSW 8 70027698 missense probably damaging 0.99
R1866:Mau2 UTSW 8 70031492 missense probably damaging 1.00
R2857:Mau2 UTSW 8 70019824 missense probably benign 0.08
R4852:Mau2 UTSW 8 70033177 critical splice donor site probably null
R4893:Mau2 UTSW 8 70030640 critical splice donor site probably null
R4970:Mau2 UTSW 8 70027703 missense possibly damaging 0.94
R5004:Mau2 UTSW 8 70025887 missense probably damaging 1.00
R5012:Mau2 UTSW 8 70031457 splice site probably null
R5248:Mau2 UTSW 8 70028723 missense probably benign 0.11
R6150:Mau2 UTSW 8 70019837 missense probably benign 0.23
R6178:Mau2 UTSW 8 70042537 missense probably damaging 0.96
R6343:Mau2 UTSW 8 70031523 missense probably damaging 0.99
R6649:Mau2 UTSW 8 70031516 missense possibly damaging 0.71
R6838:Mau2 UTSW 8 70039297 splice site probably null
R7365:Mau2 UTSW 8 70029234 missense possibly damaging 0.93
R7747:Mau2 UTSW 8 70026723 missense possibly damaging 0.46
R8039:Mau2 UTSW 8 70019790 missense probably damaging 0.96
R8222:Mau2 UTSW 8 70033177 critical splice donor site probably null
R8350:Mau2 UTSW 8 70042592 missense probably damaging 1.00
R8782:Mau2 UTSW 8 70033195 missense possibly damaging 0.74
R9145:Mau2 UTSW 8 70027515 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTGAGCAAGCCATGTAC -3'
(R):5'- AGCCCATGGTAAAAGCTGG -3'

Sequencing Primer
(F):5'- CATGGGTCTCTGAGGGCTGAAC -3'
(R):5'- GGCATACTATGTACCCTAGCTG -3'
Posted On 2018-11-28