Mutagenetix > Incidental Mutation

Incidental Mutation 'R6959:Ccl22'

541653

Institutional Source

Beutler Lab

Gene Symbol

Ccl22

Ensembl Gene

ENSMUSG00000031779

Gene Name

C-C motif chemokine ligand 22

Synonyms

MDC, ABCD-1, Scya22

MMRRC Submission

045069-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6959 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95472312-95478016 bp(+) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 95473528 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034231] [ENSMUST00000034231] [ENSMUST00000034231]

AlphaFold

O88430

Predicted Effect

probably null
Transcript: ENSMUST00000034231

SMART Domains

Protein: ENSMUSP00000034231
Gene: ENSMUSG00000031779

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SCY	33	91	4.65e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000034231

SMART Domains

Protein: ENSMUSP00000034231
Gene: ENSMUSG00000031779

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SCY	33	91	4.65e-14	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000034231

SMART Domains

Protein: ENSMUSP00000034231
Gene: ENSMUSG00000031779

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SCY	33	91	4.65e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

94% (61/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. The product of this gene binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated T lymphocytes to inflammatory sites and other aspects of activated T lymphocyte physiology. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock out allele exhibit dendritic cell physiology relating to CCR4-mediated cell contacts between dendritic cells and cytotoxic T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544D05Rik	G	A	11: 70,507,485 (GRCm39)	G177R	probably damaging	Het
Arhgef12	T	C	9: 42,927,249 (GRCm39)	T292A	probably benign	Het
Atp11a	T	A	8: 12,870,467 (GRCm39)	D173E	probably damaging	Het
Bltp1	T	G	3: 37,021,338 (GRCm39)	V2154G	probably damaging	Het
Btnl2	G	A	17: 34,582,333 (GRCm39)	V300M	possibly damaging	Het
Calcrl	A	T	2: 84,200,428 (GRCm39)	N117K	possibly damaging	Het
Castor2	T	C	5: 134,164,052 (GRCm39)	S83P	probably damaging	Het
Ccdc196	A	G	12: 78,249,070 (GRCm39)	K139E	probably damaging	Het
Cd200r1	T	A	16: 44,610,539 (GRCm39)	S216T	probably damaging	Het
Cdk5rap2	G	A	4: 70,278,906 (GRCm39)		probably null	Het
Cfap157	A	G	2: 32,674,260 (GRCm39)	I47T	probably damaging	Het
Chodl	G	A	16: 78,743,572 (GRCm39)	V220I	probably damaging	Het
Cntnap5b	A	G	1: 100,202,197 (GRCm39)	E348G	probably benign	Het
Cstf3	A	G	2: 104,479,807 (GRCm39)	T225A	probably benign	Het
Duoxa1	T	C	2: 122,134,318 (GRCm39)	S267G	probably damaging	Het
Epb41l1	G	A	2: 156,341,507 (GRCm39)	S164N	probably benign	Het
Fat3	T	C	9: 15,908,181 (GRCm39)	D2607G	possibly damaging	Het
Galnt5	A	G	2: 57,889,231 (GRCm39)	D277G	probably benign	Het
Galnt6	A	G	15: 100,612,006 (GRCm39)	I212T	probably damaging	Het
Gm45861	T	C	8: 28,038,213 (GRCm39)		probably null	Het
Gm5478	T	C	15: 101,553,883 (GRCm39)	D243G	probably damaging	Het
Gse1	A	G	8: 121,297,710 (GRCm39)		probably benign	Het
Hspg2	A	T	4: 137,246,600 (GRCm39)	Q1096L	probably benign	Het
Hycc1	T	C	5: 24,196,754 (GRCm39)	I45V	possibly damaging	Het
Idh3b	A	G	2: 130,123,447 (GRCm39)	V181A	probably damaging	Het
Igf2bp3	T	C	6: 49,094,082 (GRCm39)		probably null	Het
Ikzf2	A	G	1: 69,577,929 (GRCm39)	*382Q	probably null	Het
Impg2	A	C	16: 56,088,693 (GRCm39)	H1073P	probably benign	Het
Incenp	T	C	19: 9,854,134 (GRCm39)	E639G	unknown	Het
Kcne4	A	G	1: 78,795,603 (GRCm39)	M84V	probably benign	Het
Ktn1	T	A	14: 47,957,713 (GRCm39)	F1004I	probably damaging	Het
Lrit1	G	C	14: 36,782,052 (GRCm39)	V242L	probably damaging	Het
Malrd1	A	G	2: 16,222,820 (GRCm39)	I2040V	probably damaging	Het
Mau2	T	C	8: 70,485,878 (GRCm39)	D110G	probably damaging	Het
Mei1	T	C	15: 82,009,076 (GRCm39)	V1237A	probably benign	Het
Mfsd11	T	G	11: 116,752,495 (GRCm39)		probably null	Het
Ncapd2	A	G	6: 125,145,883 (GRCm39)	F1293L	probably benign	Het
Nf1	A	G	11: 79,440,294 (GRCm39)	T280A	probably damaging	Het
Obscn	G	T	11: 58,928,411 (GRCm39)	A6085E	probably damaging	Het
Or51b6b	T	A	7: 103,310,050 (GRCm39)	I136F	probably damaging	Het
Pdzd2	C	T	15: 12,375,993 (GRCm39)	A1381T	probably benign	Het
Pramel41	T	A	5: 94,594,891 (GRCm39)	N250K	possibly damaging	Het
Ralgapa2	A	G	2: 146,184,621 (GRCm39)	V1462A	probably damaging	Het
Rbx1	T	A	15: 81,355,163 (GRCm39)	C56*	probably null	Het
Reln	A	G	5: 22,181,562 (GRCm39)	S1774P	probably damaging	Het
Ros1	T	A	10: 52,040,090 (GRCm39)	E300D	probably damaging	Het
Sarnp	T	C	10: 128,684,137 (GRCm39)	V111A	possibly damaging	Het
Scube1	G	T	15: 83,513,636 (GRCm39)	Q345K	probably benign	Het
Slc18b1	A	G	10: 23,701,942 (GRCm39)		probably null	Het
Slc37a2	T	A	9: 37,152,630 (GRCm39)	T64S	probably benign	Het
Slit2	A	G	5: 48,395,727 (GRCm39)	D710G	possibly damaging	Het
Srp72	T	A	5: 77,142,070 (GRCm39)	Y375N	possibly damaging	Het
Tmco4	T	A	4: 138,737,810 (GRCm39)	V135D	probably damaging	Het
Trim62	A	G	4: 128,802,955 (GRCm39)	D335G	probably damaging	Het
Tsfm	T	C	10: 126,858,778 (GRCm39)	M196V	probably benign	Het
Tspan10	T	A	11: 120,335,522 (GRCm39)	C211S	probably damaging	Het
Ttc21b	A	T	2: 66,061,656 (GRCm39)	M498K	probably benign	Het
Ttc6	A	T	12: 57,704,928 (GRCm39)		probably null	Het
Ttll1	G	T	15: 83,386,397 (GRCm39)	Y69*	probably null	Het
Usp28	T	A	9: 48,912,842 (GRCm39)	L31H	probably damaging	Het
Vmn2r86	A	G	10: 130,282,400 (GRCm39)	S739P	probably damaging	Het
Wdr64	T	A	1: 175,533,555 (GRCm39)	F64I	probably damaging	Het
Ywhaq	A	G	12: 21,446,281 (GRCm39)		probably null	Het
Zfr	T	C	15: 12,150,409 (GRCm39)	S459P	probably damaging	Het

Other mutations in Ccl22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02333:Ccl22	APN	8	95,476,507 (GRCm39)	missense	probably damaging	1.00
R4082:Ccl22	UTSW	8	95,473,536 (GRCm39)	missense	probably damaging	1.00
R8273:Ccl22	UTSW	8	95,473,619 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCAGAGCGTAGACATTG -3'
(R):5'- TGGAGTTCGATACATCCTGCCTAC -3'

Sequencing Primer
(F):5'- GGACCTTTAGTGGCATCTCAGAGAC -3'
(R):5'- TCGGGCCACACTTGTCAG -3'

Posted On

2018-11-28